ID: 1098172290

View in Genome Browser
Species Human (GRCh38)
Location 12:67759150-67759172
Sequence CTTGATGCCCACGGTCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098172280_1098172290 23 Left 1098172280 12:67759104-67759126 CCACTGCAGGGGTCCAGCCTTGC No data
Right 1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG No data
1098172284_1098172290 6 Left 1098172284 12:67759121-67759143 CCTTGCTGGGTTCCCCTGTTCAC No data
Right 1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG No data
1098172287_1098172290 -8 Left 1098172287 12:67759135-67759157 CCTGTTCACATGAACCTTGATGC No data
Right 1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG No data
1098172285_1098172290 -6 Left 1098172285 12:67759133-67759155 CCCCTGTTCACATGAACCTTGAT No data
Right 1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG No data
1098172283_1098172290 10 Left 1098172283 12:67759117-67759139 CCAGCCTTGCTGGGTTCCCCTGT No data
Right 1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG No data
1098172286_1098172290 -7 Left 1098172286 12:67759134-67759156 CCCTGTTCACATGAACCTTGATG No data
Right 1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098172290 Original CRISPR CTTGATGCCCACGGTCTACC TGG Intergenic
No off target data available for this crispr