ID: 1098179306

View in Genome Browser
Species Human (GRCh38)
Location 12:67829067-67829089
Sequence GTGGACACATAGCTCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098179306_1098179309 12 Left 1098179306 12:67829067-67829089 CCATGTTTGAGCTATGTGTCCAC No data
Right 1098179309 12:67829102-67829124 CATCCCTTTTAAGCCTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098179306 Original CRISPR GTGGACACATAGCTCAAACA TGG (reversed) Intergenic
No off target data available for this crispr