ID: 1098189641

View in Genome Browser
Species Human (GRCh38)
Location 12:67934730-67934752
Sequence TCCAGGATTATCATGTCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098189637_1098189641 -1 Left 1098189637 12:67934708-67934730 CCTACTTAGCTGTACAACTCCCT No data
Right 1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG No data
1098189634_1098189641 14 Left 1098189634 12:67934693-67934715 CCAAGTCATCCCAGGCCTACTTA No data
Right 1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG No data
1098189636_1098189641 4 Left 1098189636 12:67934703-67934725 CCAGGCCTACTTAGCTGTACAAC No data
Right 1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG No data
1098189635_1098189641 5 Left 1098189635 12:67934702-67934724 CCCAGGCCTACTTAGCTGTACAA No data
Right 1098189641 12:67934730-67934752 TCCAGGATTATCATGTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098189641 Original CRISPR TCCAGGATTATCATGTCATT AGG Intergenic
No off target data available for this crispr