ID: 1098189945

View in Genome Browser
Species Human (GRCh38)
Location 12:67937525-67937547
Sequence TCCTTTTAGAAAATAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098189943_1098189945 1 Left 1098189943 12:67937501-67937523 CCACAAAATTGTCAACTCTGATG No data
Right 1098189945 12:67937525-67937547 TCCTTTTAGAAAATAACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098189945 Original CRISPR TCCTTTTAGAAAATAACCTA GGG Intergenic
No off target data available for this crispr