ID: 1098190064

View in Genome Browser
Species Human (GRCh38)
Location 12:67938511-67938533
Sequence TGGTGGACATCAATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098190061_1098190064 -9 Left 1098190061 12:67938497-67938519 CCTGTGTTCAGTGATGGTGGACA No data
Right 1098190064 12:67938511-67938533 TGGTGGACATCAATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098190064 Original CRISPR TGGTGGACATCAATGGTGGA AGG Intergenic
No off target data available for this crispr