ID: 1098190192 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:67939703-67939725 |
| Sequence | CTGACCATTAACTTAGTGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098190192_1098190197 | 28 | Left | 1098190192 | 12:67939703-67939725 | CCTATCACTAAGTTAATGGTCAG | No data | ||
| Right | 1098190197 | 12:67939754-67939776 | CACAGTCTGAGGCATTACCATGG | No data | ||||
| 1098190192_1098190193 | -9 | Left | 1098190192 | 12:67939703-67939725 | CCTATCACTAAGTTAATGGTCAG | No data | ||
| Right | 1098190193 | 12:67939717-67939739 | AATGGTCAGAATTCATGCTGTGG | No data | ||||
| 1098190192_1098190194 | 17 | Left | 1098190192 | 12:67939703-67939725 | CCTATCACTAAGTTAATGGTCAG | No data | ||
| Right | 1098190194 | 12:67939743-67939765 | GAACAGCCCATCACAGTCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098190192 | Original CRISPR | CTGACCATTAACTTAGTGAT AGG (reversed) | Intergenic | ||