ID: 1098190192

View in Genome Browser
Species Human (GRCh38)
Location 12:67939703-67939725
Sequence CTGACCATTAACTTAGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098190192_1098190193 -9 Left 1098190192 12:67939703-67939725 CCTATCACTAAGTTAATGGTCAG No data
Right 1098190193 12:67939717-67939739 AATGGTCAGAATTCATGCTGTGG No data
1098190192_1098190194 17 Left 1098190192 12:67939703-67939725 CCTATCACTAAGTTAATGGTCAG No data
Right 1098190194 12:67939743-67939765 GAACAGCCCATCACAGTCTGAGG No data
1098190192_1098190197 28 Left 1098190192 12:67939703-67939725 CCTATCACTAAGTTAATGGTCAG No data
Right 1098190197 12:67939754-67939776 CACAGTCTGAGGCATTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098190192 Original CRISPR CTGACCATTAACTTAGTGAT AGG (reversed) Intergenic