ID: 1098190194

View in Genome Browser
Species Human (GRCh38)
Location 12:67939743-67939765
Sequence GAACAGCCCATCACAGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098190190_1098190194 26 Left 1098190190 12:67939694-67939716 CCTCTGGGTCCTATCACTAAGTT No data
Right 1098190194 12:67939743-67939765 GAACAGCCCATCACAGTCTGAGG No data
1098190192_1098190194 17 Left 1098190192 12:67939703-67939725 CCTATCACTAAGTTAATGGTCAG No data
Right 1098190194 12:67939743-67939765 GAACAGCCCATCACAGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098190194 Original CRISPR GAACAGCCCATCACAGTCTG AGG Intergenic