ID: 1098196805

View in Genome Browser
Species Human (GRCh38)
Location 12:68010823-68010845
Sequence GTGATTTCCCAAGGGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098196805_1098196810 15 Left 1098196805 12:68010823-68010845 CCCTCGTGCCCTTGGGAAATCAC No data
Right 1098196810 12:68010861-68010883 TCCTTTTACTCCTATGCAAAAGG No data
1098196805_1098196813 22 Left 1098196805 12:68010823-68010845 CCCTCGTGCCCTTGGGAAATCAC No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196805_1098196812 18 Left 1098196805 12:68010823-68010845 CCCTCGTGCCCTTGGGAAATCAC No data
Right 1098196812 12:68010864-68010886 TTTTACTCCTATGCAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098196805 Original CRISPR GTGATTTCCCAAGGGCACGA GGG (reversed) Intergenic
No off target data available for this crispr