ID: 1098196806

View in Genome Browser
Species Human (GRCh38)
Location 12:68010824-68010846
Sequence AGTGATTTCCCAAGGGCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098196806_1098196813 21 Left 1098196806 12:68010824-68010846 CCTCGTGCCCTTGGGAAATCACT No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196806_1098196812 17 Left 1098196806 12:68010824-68010846 CCTCGTGCCCTTGGGAAATCACT No data
Right 1098196812 12:68010864-68010886 TTTTACTCCTATGCAAAAGGAGG No data
1098196806_1098196810 14 Left 1098196806 12:68010824-68010846 CCTCGTGCCCTTGGGAAATCACT No data
Right 1098196810 12:68010861-68010883 TCCTTTTACTCCTATGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098196806 Original CRISPR AGTGATTTCCCAAGGGCACG AGG (reversed) Intergenic
No off target data available for this crispr