ID: 1098196807

View in Genome Browser
Species Human (GRCh38)
Location 12:68010831-68010853
Sequence ATGCTGGAGTGATTTCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098196807_1098196813 14 Left 1098196807 12:68010831-68010853 CCCTTGGGAAATCACTCCAGCAT No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196807_1098196810 7 Left 1098196807 12:68010831-68010853 CCCTTGGGAAATCACTCCAGCAT No data
Right 1098196810 12:68010861-68010883 TCCTTTTACTCCTATGCAAAAGG No data
1098196807_1098196812 10 Left 1098196807 12:68010831-68010853 CCCTTGGGAAATCACTCCAGCAT No data
Right 1098196812 12:68010864-68010886 TTTTACTCCTATGCAAAAGGAGG No data
1098196807_1098196815 29 Left 1098196807 12:68010831-68010853 CCCTTGGGAAATCACTCCAGCAT No data
Right 1098196815 12:68010883-68010905 GAGGATGGTGACAATTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098196807 Original CRISPR ATGCTGGAGTGATTTCCCAA GGG (reversed) Intergenic
No off target data available for this crispr