ID: 1098196813

View in Genome Browser
Species Human (GRCh38)
Location 12:68010868-68010890
Sequence ACTCCTATGCAAAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098196808_1098196813 13 Left 1098196808 12:68010832-68010854 CCTTGGGAAATCACTCCAGCATT No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196806_1098196813 21 Left 1098196806 12:68010824-68010846 CCTCGTGCCCTTGGGAAATCACT No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196805_1098196813 22 Left 1098196805 12:68010823-68010845 CCCTCGTGCCCTTGGGAAATCAC No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196807_1098196813 14 Left 1098196807 12:68010831-68010853 CCCTTGGGAAATCACTCCAGCAT No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data
1098196809_1098196813 -2 Left 1098196809 12:68010847-68010869 CCAGCATTTCAGCTTCCTTTTAC No data
Right 1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098196813 Original CRISPR ACTCCTATGCAAAAGGAGGA TGG Intergenic
No off target data available for this crispr