ID: 1098199158

View in Genome Browser
Species Human (GRCh38)
Location 12:68036475-68036497
Sequence GAGGATGACTATAATGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 39, 3: 30, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098199158 Original CRISPR GAGGATGACTATAATGGATT TGG Intergenic
900835682 1:5001999-5002021 GAAGATGACTTTGCTGGATTTGG - Intergenic
903496387 1:23770582-23770604 GATGATGATGATGATGGATTAGG + Intergenic
905730688 1:40297351-40297373 GAGGATGACTCCAGTGTATTTGG + Intergenic
906702361 1:47869065-47869087 GAGGATGAGCATAATTCATTTGG - Intronic
906879509 1:49575193-49575215 GAGGATGACAATGATGTTTTGGG - Intronic
907367584 1:53975296-53975318 GATGGTGGATATAATGGATTTGG - Intergenic
907449748 1:54537516-54537538 GGGGATGGCTATAATGGATTTGG + Intergenic
907829241 1:58048551-58048573 GGGGATGGTTATAATGGGTTTGG - Intronic
907856163 1:58305994-58306016 GAGGAGGACTATAATGTGTGTGG - Intronic
909259019 1:73463455-73463477 GAGGATAACTAAATTGGTTTTGG - Intergenic
909850131 1:80451302-80451324 GGGGATGGCTATAATGGATTTGG - Intergenic
912884061 1:113450384-113450406 GATGGTGGATATAATGGATTTGG + Intronic
913132774 1:115857127-115857149 GGAGATGGCTATAATGGATTTGG - Intergenic
915645851 1:157271691-157271713 GAGGAAGATAATAGTGGATTGGG + Intergenic
916374647 1:164139072-164139094 AAGGATGACTATGGTGGAGTTGG + Intergenic
917185493 1:172349883-172349905 GAGGATTACTATAATGCAAGAGG + Intronic
917552252 1:176044730-176044752 AAGGATGCCTAAAATAGATTCGG - Intronic
917892918 1:179456597-179456619 GGGGATGGCTATAATGGGTTTGG - Intronic
918951528 1:191146240-191146262 GAGGATGGCTACAATGGATATGG - Intergenic
920016314 1:202912488-202912510 GAGGATGGCGATAATGGATTTGG + Intronic
920219242 1:204384299-204384321 CAGGATGACTCCAAGGGATTTGG + Intergenic
922283992 1:224152388-224152410 GAGGATTAATAAAATGGGTTTGG + Intronic
924132061 1:240920370-240920392 GGGGATGGCTATAATGGATTTGG + Intronic
1063642716 10:7847123-7847145 GATGAGGATTATAATGGAATTGG + Intronic
1063732498 10:8714253-8714275 GATGGTGACTATATTAGATTAGG + Intergenic
1065935578 10:30517831-30517853 GGGGATGGCTATAATGGATTTGG - Intergenic
1066132995 10:32412745-32412767 GAGGATAATTATAGGGGATTGGG + Intergenic
1067455468 10:46416177-46416199 GGGGATGGCTGTAATGGATTTGG + Intergenic
1067631735 10:47968458-47968480 GGGGATGGCTGTAATGGATTTGG - Intergenic
1068045570 10:51882020-51882042 GAGGATGACTAAAATGTGTGAGG + Intronic
1070949339 10:80418529-80418551 GAGGATGTCTCTAAAGGATCAGG - Intronic
1071774461 10:88769612-88769634 GATGATGGATAAAATGGATTTGG + Intronic
1075137468 10:119796986-119797008 GCTAATGACAATAATGGATTTGG + Intronic
1076196322 10:128520818-128520840 GAGGATGACTACCTTGGATGAGG - Intergenic
1077651065 11:3973154-3973176 AGGGATGGCTATAATGGATTTGG - Intronic
1077803971 11:5571467-5571489 GGGGATGGCTATAACGGATTTGG - Intronic
1080084779 11:28266562-28266584 AAGGATGACTATAAGGATTTTGG - Intronic
1080449026 11:32363544-32363566 GAGGATGAATAAGAAGGATTTGG + Intergenic
1081779971 11:45703449-45703471 GAGGATGCCTGGAATGGATTTGG + Intergenic
1082902743 11:58273444-58273466 GAGGATAACTACAATGGAGAGGG - Intergenic
1085161877 11:74355167-74355189 GGGGATGGCTATAACAGATTTGG + Intronic
1085253834 11:75160898-75160920 GAGGATGGCTATAATTGAAAAGG + Intronic
1085446245 11:76603142-76603164 GGGGGTGATTATATTGGATTGGG - Intergenic
1086644437 11:89202271-89202293 GAGGTTGTCTACAGTGGATTGGG + Intronic
1086930072 11:92683181-92683203 GAGGATGACAGGAATGGAGTGGG + Intronic
1087819241 11:102692697-102692719 AATGATGAGTAAAATGGATTTGG + Intronic
1087898177 11:103610725-103610747 AAGGATGAAAATAATGAATTAGG + Intergenic
1088344829 11:108811181-108811203 GGGGATGACTTTATTGGCTTTGG + Intronic
1088529055 11:110788249-110788271 GCAGACGGCTATAATGGATTTGG - Intergenic
1091643653 12:2256692-2256714 GAGGATGGCTAGAAAGGATGTGG - Intronic
1092499024 12:9027748-9027770 GGGGATGGCTATAATGGATTTGG - Intergenic
1093960846 12:25271176-25271198 AAGGATGAATATGATGAATTTGG + Intergenic
1095318625 12:40797755-40797777 GAGAAAGAATACAATGGATTCGG + Intronic
1096448068 12:51712795-51712817 GATGGTGGATATAATGGATTTGG - Intronic
1096826544 12:54282844-54282866 GGGGATGGCTATAATGGATTTGG + Exonic
1096985750 12:55755681-55755703 GAGAATGACTATAATGAGATAGG + Exonic
1097743447 12:63272094-63272116 GGAGATGGCTATAATGGATTTGG + Intergenic
1098199158 12:68036475-68036497 GAGGATGACTATAATGGATTTGG + Intergenic
1099509326 12:83513992-83514014 GAGGATGAGTATAATAGCCTGGG + Intergenic
1100256068 12:92884462-92884484 GGGGATGGCTATAATGGATTTGG + Intronic
1101542906 12:105681372-105681394 GAGGATGACAATGATGTTTTGGG - Intergenic
1102515748 12:113445361-113445383 GAAGATGAATAGAATGGGTTGGG + Intergenic
1102564050 12:113783041-113783063 GAGGAGGACAGTGATGGATTTGG + Intergenic
1102644417 12:114394820-114394842 GCGGATGAAAATAATGGATTTGG - Exonic
1103950552 12:124548752-124548774 GAGGGTGACTTTTATGGAGTAGG - Intronic
1105498132 13:20948528-20948550 GGGGATGGCTATAATGGATTTGG - Intergenic
1107232471 13:38126630-38126652 GAGGAGGAATTTAATGGACTTGG + Intergenic
1108667066 13:52643213-52643235 GGGGATGGCTATAATGGATTTGG + Exonic
1111201851 13:84948644-84948666 CAGTATGACTATAATAAATTTGG - Intergenic
1111836503 13:93395123-93395145 GAGTATGGCTGTTATGGATTTGG - Intronic
1117122560 14:52584044-52584066 GAGGAATACTAGAATGGAGTGGG - Intronic
1119060867 14:71472420-71472442 CATGATGACTATAAAAGATTGGG + Intronic
1120186381 14:81397704-81397726 GAGGATGACTATATTGACTTTGG - Intronic
1120281409 14:82443288-82443310 GAGGATGACTATAAAGTAAGTGG - Intergenic
1124048504 15:26173640-26173662 GAGGATGAATATCATGTTTTTGG - Intergenic
1124817713 15:33012835-33012857 GGGGGTGGCTATAATGAATTTGG + Intronic
1126986788 15:54320943-54320965 GGGGATGAATATAATGGATTTGG - Intronic
1129310225 15:74702406-74702428 GGGTATGACTGTAAAGGATTTGG + Intergenic
1129569447 15:76664398-76664420 AAGGATGACTTTAATGGTTTTGG + Intronic
1130006683 15:80106328-80106350 AGGGGTGACTAGAATGGATTTGG - Intronic
1130420129 15:83737283-83737305 AAGGAAGACTATAATTGATATGG + Intronic
1130793225 15:87178934-87178956 GGTGATAACTATCATGGATTTGG + Intergenic
1132131511 15:99284838-99284860 GGGGATGGCTACAATGGATTTGG - Intronic
1137487127 16:48900830-48900852 GAGGGTGACTAAAATGGAGAAGG - Intergenic
1137841679 16:51646538-51646560 GGGGATGGCTATAATGGATTTGG + Intergenic
1140754853 16:78057820-78057842 GTGGATGAATAAAATGGAATAGG - Intronic
1142796013 17:2307479-2307501 GGGGATGGCTATAATGGATTTGG + Intronic
1143003882 17:3814175-3814197 GACGATAACTATAATGGAAAAGG + Intronic
1149017256 17:51922700-51922722 GAAGATGGCTCTAGTGGATTGGG - Intronic
1156003471 18:32412434-32412456 GGGGATGGCTCTAATGGATTTGG - Intronic
1159355131 18:67329553-67329575 TAGGATGACAGAAATGGATTAGG + Intergenic
1162600703 19:11666288-11666310 GGGGATGGCTATAATGGATTTGG - Intergenic
1165193619 19:34083988-34084010 GAGGATGAATAGAATGCATCTGG + Intergenic
1166286202 19:41830696-41830718 GGGGATGGCTATAATGGATTTGG + Intergenic
1166451587 19:42906926-42906948 GACTTTGACTATCATGGATTTGG + Exonic
925892630 2:8448180-8448202 GAGGATGACTGTCTTGGTTTTGG - Intergenic
926065154 2:9832828-9832850 CAGGCTGACTATAAAGGATAAGG - Intergenic
926243030 2:11102567-11102589 GAAGATGATTAGAATGGCTTCGG - Intergenic
928499150 2:31870359-31870381 GAGGCAGAATATAATGGATATGG - Intronic
928674517 2:33637218-33637240 GGGGATGGCTATAATGGATTTGG + Intergenic
929365984 2:41157313-41157335 GGGGATGGCTATAATGGATTTGG + Intergenic
930559530 2:52943506-52943528 GAAGATGACTATCATGAACTTGG - Intergenic
930984601 2:57569865-57569887 GAGGATGAGTTAACTGGATTTGG - Intergenic
931578864 2:63751900-63751922 GGGGATGGCTATAATGGATTTGG - Intronic
933334978 2:80946750-80946772 GAGGATAAATATAATTCATTAGG - Intergenic
937729032 2:125204653-125204675 GAATATCACTAAAATGGATTAGG - Intergenic
938303584 2:130232843-130232865 CAGGATGGCTATAATGATTTTGG - Intergenic
938453093 2:131441417-131441439 CAGGATGGCTATAATGATTTTGG + Intergenic
942274513 2:174310235-174310257 GGGGATGGCTATAATGGATTTGG - Intergenic
942560851 2:177216910-177216932 GATGGTGGATATAATGGATTTGG + Exonic
942755769 2:179339156-179339178 GAGGATGACTGTAATTTATTTGG - Intergenic
942868782 2:180709455-180709477 GAGGATGAATAACATGGAGTGGG + Intergenic
943955831 2:194188070-194188092 GGGGTTGGCGATAATGGATTTGG + Intergenic
944194500 2:197038214-197038236 GAGGATGATGATAATGGAGGAGG + Intronic
944573058 2:201063809-201063831 GGGGATGGCTATAATGGATTTGG + Intronic
945117183 2:206419495-206419517 GGGGATGGCTATAATGGATTTGG - Intergenic
946668622 2:222077777-222077799 GATGATGATTATAATGGTGTGGG + Intergenic
1169054941 20:2612847-2612869 GATGATGACTACGATGCATTGGG + Intronic
1170093064 20:12614091-12614113 GATGATGACTAATATGGTTTGGG - Intergenic
1173779806 20:45745957-45745979 GGGAATGGCTATAATGCATTTGG - Intergenic
1179116167 21:38494447-38494469 TGGGATGCCTATAATGGCTTTGG + Intronic
1182979625 22:34656680-34656702 CAGAATGCCTATAATGGACTCGG + Intergenic
949370859 3:3333444-3333466 GAGGATGTCTATAAAGCACTTGG - Intergenic
950104161 3:10377732-10377754 GAGGAAGACAAGAATGGGTTTGG - Intronic
950165062 3:10790872-10790894 GAGAATGACTAAAATGGAAAAGG + Intergenic
951714443 3:25624415-25624437 GATGATGACTATTGTGAATTTGG - Exonic
952557484 3:34549408-34549430 GAGGATAACGATTATGGTTTTGG + Intergenic
953050320 3:39335697-39335719 GGGGATGGCTATAATGGATGTGG + Intergenic
953437494 3:42890076-42890098 GGGGATGGCTATAATGGATTTGG + Intronic
954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG + Intronic
955121986 3:56069568-56069590 GACTATGAATATGATGGATTTGG - Intronic
957028715 3:75215285-75215307 GATGGTGGATATAATGGATTTGG + Intergenic
957383420 3:79464439-79464461 TAGGATGACTATAATGAAAAAGG - Intronic
957438923 3:80216957-80216979 GGGGATGGCTATAATGGATTTGG + Intergenic
957439166 3:80220237-80220259 GATGGTGACTAAAATGGACTAGG + Intergenic
959613885 3:108325712-108325734 GGGCACGGCTATAATGGATTTGG - Intronic
960085692 3:113588742-113588764 AAGGATGAGTATTCTGGATTGGG - Intronic
960244639 3:115386719-115386741 GAGGAGGAACATAATGGAATTGG + Intergenic
960878281 3:122318358-122318380 AAGGATGGCTATAATGGATTTGG + Intergenic
963664548 3:148166556-148166578 GGGGATGGCTATAATGGATTTGG - Intergenic
963819084 3:149868455-149868477 AAGGATAACTTTACTGGATTTGG + Intronic
969855452 4:9995468-9995490 GAGGAAGAATGTAAAGGATTCGG + Intronic
971227943 4:24772189-24772211 GGGGATGGCTATAAGGAATTTGG + Intergenic
971559778 4:28063089-28063111 GGGGATGATTTAAATGGATTAGG + Intergenic
975302590 4:72807953-72807975 GGGGATGGCTATAATGGATTTGG + Intergenic
975400914 4:73938824-73938846 GGGGATGACTATAGTGGATTTGG - Intergenic
975794109 4:77988080-77988102 GGCTATGGCTATAATGGATTTGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976631448 4:87241418-87241440 GAAGATGGCCAGAATGGATTTGG + Intergenic
979729056 4:123999707-123999729 GAGGATGATGAGAATGGATCTGG - Intergenic
980868687 4:138585266-138585288 GAGGGAAACTATAATGGATTTGG - Intergenic
981334529 4:143555329-143555351 GGGGATTGCTATAATAGATTTGG - Exonic
984115706 4:175678383-175678405 GAGTACGACTAGAATGGATAGGG + Intronic
992237855 5:74730735-74730757 GAAGATGAATATAATTGATGTGG + Intronic
992808162 5:80359297-80359319 GGGGATGGCTATAATGGATTTGG - Intergenic
994887943 5:105590724-105590746 GAGCTTGCCTAAAATGGATTTGG - Intergenic
996123162 5:119693996-119694018 GAGGATAACTATAATGTCTTTGG + Intergenic
996926833 5:128837247-128837269 GATGATGATGATAATGGAATTGG + Intronic
997759315 5:136429615-136429637 GGGGATGGCTATAATGGATATGG + Intergenic
999713251 5:154337686-154337708 GGGGATGGCTATAATGGATTTGG - Intronic
1000566378 5:162852474-162852496 GAGGATGACTAGCATGGAAGTGG + Intergenic
1001884676 5:175278601-175278623 GAGCATCACTCTCATGGATTAGG - Intergenic
1003122786 6:3331426-3331448 CATGGTGACTATAATTGATTGGG - Intronic
1003379378 6:5609447-5609469 GCGGATGGCTATAATGGATTTGG - Intronic
1004051925 6:12090923-12090945 GAGGTTCAGAATAATGGATTGGG + Intronic
1005255857 6:24002187-24002209 GGGGATGGCTATAATGGATATGG + Intergenic
1005384494 6:25272529-25272551 GATGGTGAATATAATGGATTTGG - Intergenic
1006204225 6:32325936-32325958 GAGGATGGCTATAATGGATTTGG + Intronic
1011280782 6:85675370-85675392 GAGCTTGACTATAATAGACTGGG - Intergenic
1014320824 6:119925965-119925987 AAGGATGACTCTAAGGTATTTGG - Intergenic
1018689776 6:166335300-166335322 AGGGATGGCTGTAATGGATTTGG + Intronic
1021997654 7:26195861-26195883 GGGGATGGCTATAATGGGTATGG - Exonic
1022016859 7:26357710-26357732 GAGAATGACTATGAAGGACTTGG + Intronic
1023227105 7:37982321-37982343 CAGGATGGCTATAATGATTTTGG + Intronic
1025172324 7:56770703-56770725 GAGGATGCATATAGTTGATTGGG + Intergenic
1025699543 7:63804832-63804854 GAGGATGCATATAGTTGATTGGG - Intergenic
1025923750 7:65939426-65939448 GGGGATGGCTATCATGGATTTGG + Intronic
1026631274 7:72040153-72040175 GAGGTTGACATTAAAGGATTAGG - Intronic
1027964172 7:84984276-84984298 GGGGATGGCTATAATGGATTTGG + Intergenic
1028164485 7:87522181-87522203 GGGGATGGCTATAATGGATTTGG + Intronic
1028226358 7:88256545-88256567 GAGAGTGACTGTAATGGGTTTGG - Intergenic
1033036853 7:137883342-137883364 GAGGACTACTGTACTGGATTTGG - Intronic
1033781097 7:144669889-144669911 TAGGATTATTATAATGAATTTGG - Intronic
1035948282 8:3990053-3990075 GAGAATGACTAAAATGGAGTGGG + Intronic
1036180940 8:6584928-6584950 GAGGATGCCTATATTTTATTTGG - Intronic
1037876385 8:22550985-22551007 GGGGATGACCAGAATGGATGGGG + Intronic
1043589239 8:81808491-81808513 GGGGATGGCTATAAGGGATTTGG + Intronic
1043628280 8:82291844-82291866 GGGGATGGCTATAATGGATTTGG - Intergenic
1046110073 8:109712098-109712120 GATGATGAGAATCATGGATTTGG - Intergenic
1046230281 8:111347041-111347063 GAGGATGTCTGTAATGATTTTGG + Intergenic
1049209610 8:141379446-141379468 GAGGCTGACTTTAATGGTCTGGG + Intergenic
1049227110 8:141459798-141459820 GGGGATGGCTATAATGGATTTGG + Intergenic
1050373272 9:4944890-4944912 GGGGATGACTACAGTGGATTTGG - Intergenic
1052137280 9:24928565-24928587 GAAGATGACTATAATTGAAAAGG + Intergenic
1055420582 9:76136962-76136984 GAGGTTGGATAAAATGGATTTGG - Intronic
1055849177 9:80604837-80604859 GAGGATGAATATCATGCATGGGG + Intergenic
1056256489 9:84804335-84804357 GAGGATGACGATAATGATTGTGG - Intronic
1056645799 9:88410752-88410774 GGGGATGGCTATAATGGATTTGG - Intronic
1060120723 9:120987107-120987129 GAGGAAGAAAATAATGAATTTGG + Intronic
1060684510 9:125596385-125596407 AGGGATGGCTATAATGGATTTGG + Intronic
1186276381 X:7943195-7943217 GAGGATGTCTATAAAGTAATAGG + Intergenic
1188148154 X:26639509-26639531 AAGGATGATTATAATAGAGTAGG + Intergenic
1188251524 X:27901516-27901538 AAGAATCACTATTATGGATTAGG + Intergenic
1188347626 X:29086752-29086774 GAGGATTACTTAAATAGATTAGG + Intronic
1189375054 X:40460040-40460062 GAGGATGGCTAGGCTGGATTTGG + Intergenic
1192730375 X:73797321-73797343 TAGGCTGACTATAGTGGATTGGG + Intergenic
1192801839 X:74473227-74473249 GGGGATGGCTATAATGGATTTGG - Intronic
1194913115 X:99671744-99671766 GAGTATGATTTTAATGGATGAGG - Intergenic
1195023826 X:100855663-100855685 GGGGATGGCTATAATGGATTTGG - Intronic
1195027023 X:100887853-100887875 GGGGATGGCTATAATGGATTTGG - Intergenic
1195124515 X:101793296-101793318 GAGAATGAATTTAATGGATTTGG - Intergenic
1195178778 X:102336879-102336901 GAGAATGAATTTAATGGATTTGG - Intergenic
1195180086 X:102350204-102350226 GAGAATGAATTTAATGGATTTGG + Intergenic
1196763433 X:119221502-119221524 GGGGATGGCTATAATGGATTTGG + Intergenic
1198770961 X:140129597-140129619 GATGATGACAATAATAGGTTCGG + Intergenic
1199899932 X:152163089-152163111 GATGATGAATATAATGGCTCTGG - Intergenic