ID: 1098215866

View in Genome Browser
Species Human (GRCh38)
Location 12:68217726-68217748
Sequence TTTTAGCTAGAACACTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098215866_1098215867 26 Left 1098215866 12:68217726-68217748 CCTATAAAGTGTTCTAGCTAAAA 0: 1
1: 0
2: 2
3: 30
4: 271
Right 1098215867 12:68217775-68217797 TCTGTATAATTGTTAATGTATGG 0: 1
1: 0
2: 0
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098215866 Original CRISPR TTTTAGCTAGAACACTTTAT AGG (reversed) Intronic
904241767 1:29151185-29151207 TTTTAGCAAGAATACTTCATAGG - Intronic
904856803 1:33504113-33504135 TTTTGGCAAGAATACTTCATAGG + Intergenic
907145698 1:52229261-52229283 TTTTGGCAAGAATACTGTATAGG + Intronic
907645625 1:56240068-56240090 TTTTAACAAGACAACTTTATAGG - Intergenic
907697201 1:56743716-56743738 TTTTACTTAAAACACTTTCTTGG - Intronic
907929549 1:58986658-58986680 ATTTAGCTTGAACCCTTTACAGG - Intergenic
909004045 1:70254890-70254912 TTTTTGTAAGAACATTTTATTGG - Intergenic
909026053 1:70483436-70483458 TTTTATCCAAAACATTTTATAGG + Intergenic
909319559 1:74266251-74266273 ACTTAGCTAGAACAGTTGATTGG + Intronic
911345963 1:96697100-96697122 TTTTGGCTATAATTCTTTATAGG + Intergenic
911427028 1:97729904-97729926 ATTTAGCTAGAACAATATAGAGG - Intronic
912476448 1:109939787-109939809 TTTTTGTAAGAACACTTCATAGG + Intergenic
914695550 1:150075443-150075465 TCTTGGCAAGAATACTTTATAGG + Intronic
917654848 1:177115923-177115945 TTTTCCATTGAACACTTTATTGG + Intronic
918429696 1:184446435-184446457 TTTTGGCAAGAATAATTTATAGG - Intronic
919483401 1:198117129-198117151 TTTTAGCAAGAAATCTTTGTTGG - Intergenic
919696598 1:200582930-200582952 TTTTAGCAAGAATACTTGGTAGG - Intronic
923259172 1:232250465-232250487 TTTTAGCTAAAACACATTGTAGG + Intergenic
923264954 1:232305480-232305502 TTTTTAGTAGAACAATTTATTGG - Intergenic
923637917 1:235719671-235719693 TTTTGGCAAGAATCCTTTATAGG - Intronic
923727200 1:236516888-236516910 TTTTGGCCAGAAGACTTTACAGG - Intergenic
1063473599 10:6308876-6308898 TTTTGGCAAGACTACTTTATGGG - Intergenic
1063648904 10:7913785-7913807 ATTTGGCAAGAACAGTTTATAGG - Intronic
1065829412 10:29600791-29600813 TTTTAGTTAGAACAGTCTTTCGG - Intronic
1068691185 10:59916555-59916577 TTTTAGCAAGAATACTTCATAGG + Intergenic
1068857457 10:61812005-61812027 TTTTAAAAATAACACTTTATTGG - Intergenic
1069096144 10:64262200-64262222 TTTCGGCTAGAATACTTCATAGG - Intergenic
1069724193 10:70566881-70566903 TTTTAGAAAGAACTTTTTATAGG + Exonic
1070085563 10:73233723-73233745 TGTTGGCTAGAATACTATATTGG + Intronic
1070232823 10:74588571-74588593 TTTAGGTTAGAATACTTTATAGG + Intronic
1071002909 10:80851249-80851271 ATTTATCTAAAACAGTTTATAGG - Intergenic
1071732803 10:88266056-88266078 TTTTATCTAGGGCACTTTATTGG + Intergenic
1072528989 10:96300490-96300512 TTTTGCCTGGAACACTTCATGGG + Intergenic
1072942744 10:99781648-99781670 TTTTAGCTAGGATACTGCATGGG + Intergenic
1073041562 10:100611047-100611069 TTTTGGCAAGAATATTTTATAGG - Intergenic
1073744145 10:106446172-106446194 TTTGGACAAGAACACTTTATAGG + Intergenic
1074647106 10:115469166-115469188 TTTTAGCTGGAACAATATCTGGG + Exonic
1080204034 11:29708237-29708259 TCTCAGCTACAACACTTTTTAGG + Intergenic
1081267133 11:41038771-41038793 TTTTAATTAAAACACTTTAGGGG - Intronic
1083983296 11:66192162-66192184 TTTTAGCTAGAAGCCATTTTAGG + Intronic
1085108469 11:73866546-73866568 TTTTAGCTAGTACAGGTTAGGGG + Intergenic
1085785644 11:79446223-79446245 TCTCAGCTACCACACTTTATTGG + Intergenic
1086974759 11:93118998-93119020 TTTTTCCTAGACCACTTTGTTGG + Intergenic
1087600526 11:100309445-100309467 TTACAGCAAGAACAATTTATGGG + Intronic
1087770374 11:102202866-102202888 TTTTGGCAAGAATACTTCATTGG - Intronic
1088526443 11:110761371-110761393 TTTTACCTTGATGACTTTATGGG - Intergenic
1091800634 12:3322476-3322498 TTTTAAAAAGAACAGTTTATGGG + Intergenic
1093650396 12:21637170-21637192 TTTTAGCTTGATGACTTCATAGG + Exonic
1097589698 12:61559340-61559362 TTTTGGGAAGAACACTTGATAGG + Intergenic
1098215866 12:68217726-68217748 TTTTAGCTAGAACACTTTATAGG - Intronic
1098235046 12:68410215-68410237 TTTTGGCTAGAATGCTTTATAGG + Intergenic
1098824509 12:75277370-75277392 TTTTAACAAGAACAATTTGTAGG + Intronic
1098933325 12:76447373-76447395 TTTTGGCAAGAATACTTTGTAGG - Intronic
1099135828 12:78899829-78899851 TTATAGCTAGATTATTTTATAGG + Intronic
1099630393 12:85135322-85135344 TTTTAGCAAGAATATTTCATAGG + Intronic
1100618743 12:96251430-96251452 CTTTCTCTTGAACACTTTATAGG - Intronic
1101171388 12:102099537-102099559 TTAGAGCTAGAAAACTTTTTAGG + Intronic
1101179237 12:102193352-102193374 TTTTATTTAGAATATTTTATGGG + Intronic
1101474447 12:105031385-105031407 TTTTGGCAGGAACACTTCATAGG + Intronic
1101532299 12:105584699-105584721 TTTTAGCTTGAACACCTGGTGGG + Intergenic
1101939037 12:109085610-109085632 TTTTAACAAAAAGACTTTATAGG - Intronic
1102086768 12:110148309-110148331 TTTTGGCAAGAAAACTTTCTAGG + Intronic
1103679583 12:122682647-122682669 TTTTAGCTTGACCACTCTTTGGG - Intergenic
1104632550 12:130415903-130415925 TCTCAGCTTGAACAATTTATTGG - Intronic
1106185507 13:27406425-27406447 TTTCACCATGAACACTTTATTGG - Intergenic
1106255407 13:28018038-28018060 ATTTAGCTTTAACATTTTATAGG + Intronic
1106718434 13:32415309-32415331 CTTTAGCAAGCACACTTTGTTGG - Intronic
1107526608 13:41238831-41238853 TTTGAGCGAGAATACTTCATAGG - Intronic
1107626283 13:42288911-42288933 TTATGGCAAGAATACTTTATAGG + Intronic
1107663103 13:42659769-42659791 TTATAGCTTGAAGACTTTGTAGG - Intergenic
1108150377 13:47527615-47527637 TCTTAACTAGAACAATTAATTGG + Intergenic
1108930638 13:55813728-55813750 TTTTAGCAAGAAAACTTCATAGG - Intergenic
1109696005 13:65958784-65958806 TTTTAGCTATAAAAGTTTGTCGG + Intergenic
1109698999 13:66001021-66001043 TTTAATCTAGAACAGTTTAGTGG + Intergenic
1110057958 13:71001092-71001114 ATATACTTAGAACACTTTATAGG + Intergenic
1110414048 13:75232914-75232936 TTTTGGCCTGAACACTTCATAGG - Intergenic
1111464606 13:88592562-88592584 TTGGAGCTGGAAAACTTTATTGG - Intergenic
1111815403 13:93146841-93146863 TTTTAATAAGAATACTTTATGGG + Intergenic
1111936218 13:94559421-94559443 TTTTAGCAAGAAACCTTCATAGG - Intergenic
1112810839 13:103216734-103216756 TTTTGTCTAGAACTCTTCATTGG + Intergenic
1112879625 13:104090267-104090289 GATTAGCTAGAACACATTCTAGG + Intergenic
1115524832 14:34269408-34269430 TTTAATCAAGAACACTTTGTAGG + Intronic
1117102073 14:52360010-52360032 TTTTGGCAAGAATACTTCATAGG - Intergenic
1117907611 14:60606492-60606514 TTTTGGCAAGAATATTTTATAGG + Intergenic
1117961551 14:61168191-61168213 TTTTAGCTCCAACAATTGATAGG - Intergenic
1118400877 14:65378554-65378576 TTATGGCTGGAAGACTTTATGGG - Intergenic
1119427629 14:74546139-74546161 GATTTGCTAGAACACTTTACTGG + Intronic
1120182643 14:81360785-81360807 TATTAGTTATAACAGTTTATTGG - Intronic
1121160547 14:91735506-91735528 TTTTGTCAAGAACACTTCATAGG + Intronic
1122000880 14:98651514-98651536 TTGTAGCAAGAACACTTCACTGG - Intergenic
1125440345 15:39695386-39695408 CTTTGGCAAGAAAACTTTATAGG - Intronic
1126011733 15:44309517-44309539 TTTTAGCTAAAACAATAAATTGG - Intronic
1126984895 15:54294752-54294774 GTTTAATTAAAACACTTTATAGG - Intronic
1127162009 15:56198447-56198469 TTTCAGCAAGAATACTTTGTAGG - Intronic
1127638409 15:60892886-60892908 ATTTAGCTGGAACATTGTATCGG + Intronic
1128971204 15:72108311-72108333 TTTTGGCAAGAACACTCTGTAGG - Intronic
1129596804 15:76971396-76971418 TTTTGGCAAGAATACTTCATAGG - Intergenic
1129793203 15:78355934-78355956 TTTTGGCAAGAATACTTCATAGG + Intergenic
1130061663 15:80574847-80574869 TTTGGGCTGGAACATTTTATCGG - Intronic
1131653317 15:94426725-94426747 TTTTTACTAGAACATTTTAAAGG + Intronic
1133406726 16:5530483-5530505 GTTTAGCTTGAAGACTTTATAGG - Intergenic
1134451458 16:14366374-14366396 TTATAGCTTGAACACTTGCTGGG + Intergenic
1135507034 16:23047832-23047854 TTTAAGCTAGGACACTTCAATGG + Intergenic
1136945351 16:34643880-34643902 TTTTAGCTGTAGGACTTTATTGG - Intergenic
1137520167 16:49187105-49187127 TTTTATATAGAATTCTTTATGGG - Intergenic
1138639994 16:58377853-58377875 TTTTGGCAAGAATACTTTGTAGG + Intronic
1139100254 16:63757820-63757842 TTTTAGGTTTAACACTTTGTTGG - Intergenic
1144993720 17:19251823-19251845 TTTTAGATAGTAGACTTTTTTGG + Intronic
1146433245 17:32819015-32819037 TTGTAGATAGAACACTTTCCAGG - Intronic
1149145370 17:53484904-53484926 ATATAGCTATAATACTTTATTGG - Intergenic
1156231062 18:35154285-35154307 TTTTAGCTTAAACATTTAATTGG - Intergenic
1156281576 18:35644388-35644410 TATTGGCCTGAACACTTTATAGG + Intronic
1156639404 18:39072249-39072271 TTCTAGATTGAACACTTTTTTGG + Intergenic
1156926055 18:42581083-42581105 TTTTAGAAAGGCCACTTTATTGG + Intergenic
1158053089 18:53247355-53247377 TTTTAAATACAACATTTTATGGG - Intronic
1158299064 18:56032260-56032282 TTTTAGCTGGATCACTTTCCTGG - Intergenic
1158302854 18:56072172-56072194 TTTTGTCTAAAACACTTTATAGG - Intergenic
1159301610 18:66579273-66579295 TTTTTGGTAAAATACTTTATAGG - Intronic
1160147154 18:76375190-76375212 TTCTGGCTACAACACTTTAAGGG + Intronic
1160294542 18:77625262-77625284 TCTTACCTAGAATACTCTATGGG + Intergenic
1164963900 19:32462495-32462517 TTTTGGCAAGAACACTTCACGGG - Intronic
1165664478 19:37615547-37615569 TTTTAGCAAGAATACTTCATAGG + Intronic
1166019982 19:40018364-40018386 TTTTGGCAAGAATACTTAATGGG + Intergenic
1167855741 19:52238187-52238209 TTTGAGATAGAACCCTTTAAGGG + Intergenic
926846195 2:17142498-17142520 TTTTTGCTACAATACTCTATTGG - Intergenic
927613954 2:24570679-24570701 TTTTGGCAAGAATACTTCATGGG - Intronic
927769867 2:25850523-25850545 TTTTAGCAAGAAAACTTCATAGG + Intronic
928631019 2:33192352-33192374 ATTTGGCAAGAACACTTCATGGG - Intronic
929426815 2:41852166-41852188 TTTTATCAAGAATGCTTTATTGG - Intergenic
930743133 2:54854164-54854186 TTTTAGTTACAACATTTTAACGG - Intronic
930857831 2:56038334-56038356 CTTTTGCCTGAACACTTTATAGG - Intergenic
931682021 2:64758871-64758893 TTTTAGCTGGGACACTTTGAGGG + Intergenic
931737301 2:65208062-65208084 TTTTGGCAGGAATACTTTATAGG + Intergenic
933146561 2:78860842-78860864 TTCTATCTAGAACAATTTCTGGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933932476 2:87167640-87167662 TTTTAGAAAGAAAATTTTATTGG + Intergenic
935228549 2:101076457-101076479 TTTTAGGAAGAATACTCTATAGG - Intronic
936360635 2:111797801-111797823 TTTTAGAAAGAAAATTTTATTGG - Intronic
936667757 2:114616923-114616945 TTTTGGCAAAAACACTTCATAGG - Intronic
937682240 2:124656364-124656386 TTTTAGCTGTATCACTTTAAGGG - Intronic
939285449 2:140123289-140123311 TTTTGTCTAGAACACTTAATTGG + Intergenic
940930676 2:159425944-159425966 AATTAACTAGAACACTTTTTTGG + Intronic
941150638 2:161910010-161910032 TTCTAGCTATAACATTTTCTAGG - Intronic
941270259 2:163417442-163417464 TTATAGCTAGTACATTTTGTTGG - Intergenic
941758116 2:169210450-169210472 ATTTAGCAATAATACTTTATAGG - Intronic
942298766 2:174542050-174542072 TTTTGGCAAGAACACTTTATAGG + Intergenic
942836853 2:180310349-180310371 TTTTAGCTTCACCATTTTATTGG - Intergenic
943790455 2:191926115-191926137 TTTTAGTTGCAACACTTTCTTGG + Intergenic
944823494 2:203456164-203456186 TTTTAACTAAAACACTGTTTCGG + Intronic
945538971 2:211059410-211059432 TTTAAGGTAGAACAATTTAAAGG - Intergenic
1168823888 20:795832-795854 TTTTTGATAGAACAGTTTACGGG - Intergenic
1169181323 20:3570409-3570431 TTTTGGCAAGATCACTTCATAGG + Intronic
1169312923 20:4562499-4562521 GTTAAGCTAGATAACTTTATGGG - Intergenic
1170433497 20:16298724-16298746 TTTTTGCAAGAACACTTTATAGG - Intronic
1171322022 20:24254712-24254734 TTTTGGCAAGAACAATTCATGGG - Intergenic
1171984885 20:31653000-31653022 TTTTGGCAAGAATATTTTATGGG + Intergenic
1173206286 20:40996887-40996909 TTTTAGCAAGAATGCTTCATAGG - Intergenic
1176013743 20:62916692-62916714 TTTTAGCTGAAACACTCTATGGG - Intronic
1177544797 21:22543191-22543213 TTTTAGCTAAAACACTGTTGAGG + Intergenic
1179228869 21:39482101-39482123 ATTTAGCAAGAACACTTGACTGG - Intronic
1179565371 21:42244461-42244483 TTTTAGCTTTATCAATTTATTGG - Intronic
1183792645 22:40085647-40085669 TTTTGGCAAGAATATTTTATAGG + Intronic
949649239 3:6136117-6136139 TTTTGGCAAGAATACTTCATAGG + Intergenic
949890709 3:8731841-8731863 TTTTAGCTTGAGCACATTTTCGG - Intronic
949922812 3:9016451-9016473 TTTTGGCAAGAACACTACATGGG + Intronic
950814930 3:15690983-15691005 TTTTAGCTATGGCACATTATGGG - Intronic
951114512 3:18844281-18844303 TTTAAAGTAGGACACTTTATTGG - Intergenic
953483493 3:43272827-43272849 TTTTGGCTAGAAAACTTAATAGG + Intergenic
954279520 3:49566397-49566419 TTTTGGAAAGAACACTTCATTGG + Intronic
956407244 3:68940793-68940815 TTTTGGCTAGGACGCTTTCTCGG - Intergenic
957500245 3:81047112-81047134 ATTTATGTAGAACAATTTATTGG + Intergenic
957823540 3:85410669-85410691 TTTAAGCTACAACAAGTTATTGG + Intronic
957944969 3:87052401-87052423 TTGTTGCTGAAACACTTTATGGG - Intergenic
958781262 3:98546095-98546117 TTGAAGCTAGAAAACTTTCTAGG - Intronic
959491470 3:106994344-106994366 TTTTAGCTCTAACAGTTTTTTGG - Intergenic
960143790 3:114176914-114176936 TTTTATCTAGAAAACTTGATAGG - Intronic
960918630 3:122723607-122723629 TTTTTGCAAGAATACTTCATAGG + Intronic
961100814 3:124197522-124197544 TTCTAGCTAGAACACTTTTCCGG + Intronic
961135136 3:124503018-124503040 TTTAAGATAGCACACTTAATGGG - Intronic
961240787 3:125409359-125409381 TTTTGGCAAGACTACTTTATAGG + Intergenic
962490069 3:135884553-135884575 TTTTAACTAGAACAGCTAATAGG - Intergenic
962515664 3:136148481-136148503 TCTTAGTTAAAACAATTTATTGG - Intergenic
962696848 3:137957752-137957774 TTTTGGCTAGAATATTTCATAGG + Intergenic
963765082 3:149326334-149326356 TTTTAGCGAGAATACTTAATGGG + Intronic
964301370 3:155289066-155289088 TTTTGGCAAGAATACTTCATAGG + Intergenic
966111299 3:176405110-176405132 TTTTAGCCAGAATACTTCACAGG + Intergenic
970212263 4:13721916-13721938 TTTTTGCAACAACACTTAATAGG + Intergenic
971483578 4:27137026-27137048 TGGTAGCTTGAACATTTTATAGG + Intergenic
972363132 4:38347352-38347374 TTTTGGCAAGAATACTTTCTAGG + Intergenic
972853172 4:43074389-43074411 TTTTGGCTAGCACATTTGATAGG - Intergenic
972905233 4:43737519-43737541 TTTTAACTAACAGACTTTATTGG - Intergenic
973299706 4:48567368-48567390 TTTTCTCAACAACACTTTATTGG - Exonic
973972331 4:56225876-56225898 TTTTAGGTAGAACCCATTCTTGG + Intronic
974943641 4:68499622-68499644 TTTTAACTAGCACATTTTGTTGG - Intergenic
975953518 4:79805807-79805829 GTTTTGCAAGAAAACTTTATAGG - Intergenic
976258273 4:83121262-83121284 TTTTGGCAAGAATACTTCATAGG + Intronic
976486717 4:85614072-85614094 TTTTCTTTAGAAAACTTTATTGG + Intronic
978135847 4:105258342-105258364 TATTAGCTGGAATACTTTACAGG + Intronic
978390367 4:108218974-108218996 TTTTAGATAGGAAACTTCATAGG - Intergenic
978602791 4:110446203-110446225 TTCTAGCAAGAACACCTTGTAGG + Intronic
979539726 4:121868239-121868261 TTTTGGCTTGACAACTTTATAGG - Intronic
979693429 4:123584790-123584812 TGTTAGCTACAACAGTTTATGGG - Intergenic
980039481 4:127922973-127922995 TTTTGGCAAGAATACTTTATAGG - Intronic
980376843 4:131960398-131960420 CTTTATGTAGAAAACTTTATAGG - Intergenic
981227646 4:142315426-142315448 TTTCAGCTAGAACACCTTTTTGG - Intronic
983416667 4:167465233-167465255 TTTTAGCAAGATCAGTCTATTGG - Intergenic
983509656 4:168593943-168593965 GTTTAGCTAGATGAGTTTATTGG + Intronic
983996213 4:174185726-174185748 TTGTAGCTATATCAGTTTATAGG + Intergenic
984306747 4:178001797-178001819 TTTGAGCAAGAATACTCTATAGG - Intergenic
984339959 4:178444500-178444522 TATTAGATAGAAAATTTTATCGG - Intergenic
985277076 4:188247867-188247889 CTTTAGGCCGAACACTTTATAGG + Intergenic
986944739 5:13002354-13002376 TTTTAGGAAAAACACTTTTTAGG - Intergenic
987731923 5:21784547-21784569 TTTTAAATATAACATTTTATGGG + Intronic
989668361 5:43883571-43883593 TGTTTGCTAGTACACTGTATAGG + Intergenic
990178297 5:53131716-53131738 TTTTAATTAGAATATTTTATGGG + Intergenic
990772129 5:59259976-59259998 TTTTTTCTACAAAACTTTATAGG + Intronic
993219784 5:85077725-85077747 TTTTGGCTAGAATATTTCATTGG + Intergenic
994050554 5:95357512-95357534 TTTTATCTTGCAGACTTTATGGG - Intergenic
994645093 5:102458282-102458304 ATTTAGGTTGAACCCTTTATGGG + Intronic
994830751 5:104779958-104779980 TTTTAATAAGAACACTTCATAGG + Intergenic
994914016 5:105949004-105949026 TTTTATCCAGAACAGTCTATGGG + Intergenic
995281977 5:110345911-110345933 TTTTGGCTGGACCTCTTTATTGG + Intronic
995453210 5:112325498-112325520 TTATAGCTAAAGTACTTTATGGG - Intronic
995579719 5:113583845-113583867 TTTTAACAAGAATATTTTATAGG + Intronic
995803673 5:116027599-116027621 TCTCAGCTACAACACTTTGTAGG - Exonic
995805561 5:116048157-116048179 TTTGTGTTAGAACACTTTATGGG + Intronic
996936484 5:128955230-128955252 TTTTGGCAAGAATACTTCATAGG - Intronic
997706498 5:135958638-135958660 TTTTGACAAGAATACTTTATAGG - Intergenic
997921177 5:137980843-137980865 TATTATCTAGAACACTTAGTAGG - Intronic
998008050 5:138670603-138670625 TTTTAGCAAGAACATATTTTGGG + Intronic
1001261348 5:170232494-170232516 TTTTTCCTATAACATTTTATAGG - Exonic
1002992804 6:2253461-2253483 TTCAAGCTAGAAAACTTCATTGG + Intergenic
1005765723 6:29010020-29010042 TTTTGGCAAGAATACATTATAGG + Intergenic
1007330699 6:41105394-41105416 TTTTCTCAAGAACGCTTTATTGG - Intergenic
1007470924 6:42089691-42089713 TTTTACATGGAACACATTATTGG + Intergenic
1007828829 6:44622399-44622421 ACTTAGCTAGCACACCTTATAGG - Intergenic
1010284772 6:74063427-74063449 TTTTCTCTAGTCCACTTTATAGG + Intergenic
1012554320 6:100493091-100493113 TTTTACCAAATACACTTTATGGG + Intergenic
1013332540 6:109119258-109119280 TTTTAGGTAGATCACTCTAGGGG + Intronic
1013787837 6:113801974-113801996 TTTTGGCAAGAATACTTTAAAGG - Intergenic
1013988528 6:116225753-116225775 TTTTAGCTAGAAGACAGTGTAGG + Intronic
1014052426 6:116970732-116970754 TTTAAGCAAGATTACTTTATAGG + Intergenic
1014303169 6:119709113-119709135 TTTTAGTTCGAACGCTGTATCGG + Intergenic
1014576916 6:123085079-123085101 TTTAAGCAAAATCACTTTATAGG + Intergenic
1014790984 6:125671914-125671936 TTTAGGCAAGAACACTTAATAGG - Intergenic
1015073770 6:129130020-129130042 TTTCAGCTACAGCACATTATTGG + Intronic
1015706950 6:136098507-136098529 TTCTAATAAGAACACTTTATGGG + Intronic
1017369330 6:153686590-153686612 TTTTACCTATAAAACTTTTTGGG - Intergenic
1017857265 6:158360774-158360796 TTTTTGCTAGACCTCTTTATTGG - Intronic
1017864740 6:158433311-158433333 TTTTGGCAAGAATACTTTAAAGG + Intronic
1019657833 7:2206742-2206764 TTATGGCTATAACAATTTATAGG + Intronic
1022119693 7:27296111-27296133 TTTTGGCAAGAATACTTTATGGG - Intergenic
1023178920 7:37461410-37461432 TTTTGGCAAGAACACTTCATGGG + Intergenic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1024663003 7:51517224-51517246 TCTTATCACGAACACTTTATTGG + Intergenic
1025960464 7:66216192-66216214 TTTTATCTAGATTACTTTGTTGG + Intronic
1027845154 7:83363489-83363511 TATAAGCTAGAGCACTATATGGG - Intergenic
1028224984 7:88239734-88239756 TTTTAGCTGGTCCACTTTGTGGG + Intergenic
1032064461 7:128755402-128755424 TTTTAGGTCCAACACTTTACTGG - Intronic
1032926067 7:136606350-136606372 TTTTAGCAAGAATATTTCATAGG - Intergenic
1038559975 8:28566965-28566987 TTTTAAGTAGAATAATTTATGGG - Exonic
1038976053 8:32697395-32697417 TTTTAGCTTGAACAAATTAGAGG + Intronic
1040714791 8:50237332-50237354 TTTTGGCAAGAATACTTTATTGG + Intronic
1041963023 8:63641481-63641503 TTTTGCCTAGAACTCTTAATTGG + Intergenic
1042132709 8:65604397-65604419 TTTTATCCAGATCATTTTATTGG - Exonic
1042546873 8:69958851-69958873 TTTTACCTAAATCATTTTATGGG + Intergenic
1043712009 8:83432206-83432228 TTTCAGCTACAACAATTAATAGG + Intergenic
1043771615 8:84208942-84208964 TTTTAGCTGGAAGACTGTATTGG + Intronic
1044773595 8:95663833-95663855 TTTTGGCTTGAACACATCATAGG - Intergenic
1044969236 8:97603967-97603989 TTTCAGCGAGACCACTTCATAGG - Intergenic
1045168298 8:99631954-99631976 CTTTAGCTAGAATAATTTATTGG - Intronic
1045434495 8:102147889-102147911 TTCTATCTAGAACTCTTTGTTGG - Intergenic
1045581853 8:103490306-103490328 TTTTAGCAAGACAACTTCATGGG + Intergenic
1045969790 8:108066943-108066965 TTTTGGCTGGAACACTGTGTAGG - Intronic
1049051741 8:140202822-140202844 TTTTGCCTAGAATACTTCATAGG - Intronic
1050494596 9:6227831-6227853 TTCTACCTAGAAAACTTTCTAGG + Intronic
1050605075 9:7292460-7292482 TTTTGGCAAGAAGACTTCATAGG - Intergenic
1051008625 9:12381678-12381700 TTTTAGCAAGAGTACTTTATAGG + Intergenic
1051494298 9:17701550-17701572 GTATACCTAGAAAACTTTATGGG + Intronic
1052506656 9:29363241-29363263 TTTTTGCTGGATCAGTTTATTGG + Intergenic
1052716193 9:32120488-32120510 TTTTAACCATAACACTTTAGTGG + Intergenic
1055209682 9:73775693-73775715 TTTTAGCAAAAGCACTTTATAGG - Intergenic
1055878995 9:80976027-80976049 TTTAAGCTAGAAAACTTCTTAGG + Intergenic
1056337827 9:85593177-85593199 TTTTGGCAAGAATACTTAATAGG - Intronic
1057887496 9:98841316-98841338 TTTTGGCAAGAACACTTTGTGGG + Intronic
1058324300 9:103676480-103676502 TTGTAGTTACATCACTTTATGGG + Intergenic
1059559935 9:115324399-115324421 TTTTTTTTTGAACACTTTATTGG - Intronic
1059583819 9:115583251-115583273 TTTAAGCTATAACAGTATATTGG + Intergenic
1185982717 X:4797367-4797389 TTTTATCAAAAATACTTTATAGG - Intergenic
1186061882 X:5717850-5717872 TTTTTGATAGAACAATTTTTTGG - Intergenic
1186898417 X:14028847-14028869 TTTTTGCTAGCATAATTTATCGG - Intronic
1187335032 X:18374490-18374512 TTGTAGTAAGAACACTTTGTCGG + Intergenic
1187978429 X:24728968-24728990 TTTTAGCCAAAATGCTTTATAGG + Intronic
1188922354 X:35992628-35992650 TTTAAGCTAGAATAATTTAAAGG - Intergenic
1189887569 X:45563888-45563910 TTTTAGATACACCACTTTAGAGG - Intergenic
1190754110 X:53386078-53386100 TTTTGGCAAGAACATTTCATTGG - Intronic
1190885243 X:54525872-54525894 TTTTAGCAAGAACAGTACATAGG - Intergenic
1191102395 X:56745853-56745875 TTTTAGCAAGAAGACTACATGGG + Intergenic
1192574611 X:72233199-72233221 TTTTGGCATGAATACTTTATAGG - Intronic
1193432835 X:81432333-81432355 TTTTAGCTAGAGTCCTTCATAGG + Intergenic
1196128775 X:112129487-112129509 TTTTTGCTAATACATTTTATCGG - Intergenic
1197183968 X:123565809-123565831 GTTTAACAAGAATACTTTATTGG - Intergenic
1199991930 X:152992364-152992386 TTTTTGCTAGTACGCTTTATTGG - Intronic
1201360261 Y:13139067-13139089 TTTTATAAAGAACACTTTCTGGG - Intergenic