ID: 1098216696

View in Genome Browser
Species Human (GRCh38)
Location 12:68228035-68228057
Sequence TGTTATTTAGGACACTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098216696_1098216702 12 Left 1098216696 12:68228035-68228057 CCCCCAAAGTGTCCTAAATAACA 0: 1
1: 0
2: 2
3: 13
4: 228
Right 1098216702 12:68228070-68228092 GAATAAATGCATAATACTGTAGG 0: 1
1: 0
2: 2
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098216696 Original CRISPR TGTTATTTAGGACACTTTGG GGG (reversed) Intergenic
901279178 1:8019241-8019263 TTTTATTTAGGAGCCTTTGAAGG - Intronic
905194896 1:36268355-36268377 TGACATTTTGGACATTTTGGAGG + Intronic
905254592 1:36672019-36672041 TATGATTTAGGGCACTCTGGAGG - Intergenic
907059312 1:51405112-51405134 TTTCAGTTAGGACAGTTTGGAGG - Intronic
907893091 1:58654625-58654647 TGTTATATAGAACACTGTAGGGG - Intergenic
908293428 1:62690001-62690023 TGTTTTTTAGAACACCTAGGTGG - Intergenic
908497533 1:64709780-64709802 TGTTATTTTGGACACATAGTGGG + Intergenic
909410578 1:75345798-75345820 GCTTATTTAGAAGACTTTGGGGG - Intronic
911273997 1:95839491-95839513 TTTTAATTAAGACACTTTGCTGG + Intergenic
913560855 1:120017927-120017949 TGCTATTGAGGCCACTTTGTAGG - Intronic
914281439 1:146177339-146177361 TGCTATTGAGGCCACTTTGTAGG - Intronic
914513255 1:148352822-148352844 TTCTAGTCAGGACACTTTGGGGG - Intergenic
914542484 1:148628275-148628297 TGCTATTGAGGCCACTTTGTAGG - Intronic
914624149 1:149442969-149442991 TGCTATTGAGGCCACTTTGTAGG + Intergenic
915911685 1:159919404-159919426 TGGTATCTAGGACACTGCGGAGG - Intronic
916557619 1:165906976-165906998 TGTTTTTTAAGACATTTTTGAGG + Intronic
916918432 1:169437066-169437088 AGTTTTTAAGGACAATTTGGTGG + Intronic
917015810 1:170530398-170530420 TGTTCTTTAGTTCACTCTGGGGG - Intergenic
917759858 1:178144295-178144317 TGATTTTTAAGACACTTTGTGGG + Intronic
921965116 1:221079820-221079842 GGCTATTTAGGGCACTTTCGTGG + Intergenic
922509883 1:226156002-226156024 TATTACTTAGGTAACTTTGGTGG + Intronic
922574626 1:226653638-226653660 TGTTCTTGAGGACACTTCGGTGG + Intronic
924782227 1:247161125-247161147 TGTTATTCAGAAGACTTTGACGG - Intronic
1063184410 10:3637709-3637731 TGTCATTTGAGAGACTTTGGAGG - Intergenic
1063683521 10:8213340-8213362 TCTTATTTAGGACACTGTAAAGG + Intergenic
1065044485 10:21734623-21734645 TGTTATTAAGCATACTTTTGGGG + Intronic
1065675886 10:28174088-28174110 TGTTTTTGAAGCCACTTTGGGGG - Intronic
1065981254 10:30900379-30900401 TGTTATTTGGGCTATTTTGGTGG - Intronic
1066814683 10:39391063-39391085 TGATATTTGGGAGCCTTTGGAGG + Intergenic
1067846669 10:49729214-49729236 TTTTAGTTAGGACACTATGATGG + Intergenic
1068231664 10:54175383-54175405 TGTTATTTAGTGCTCTGTGGAGG - Intronic
1068311553 10:55283350-55283372 AGTTTTTAAGGATACTTTGGTGG - Intronic
1071551450 10:86569280-86569302 AGTTTTTAAGGACAATTTGGTGG + Intergenic
1072767424 10:98106853-98106875 GTTTTTTAAGGACACTTTGGAGG - Intergenic
1074534564 10:114319633-114319655 TGTTATGCAGGTCACTCTGGCGG - Intronic
1075512469 10:123083654-123083676 TGTCATTTAGGACACCTAGTTGG + Intergenic
1076079929 10:127570143-127570165 TGGTATTTGGGAAACTCTGGTGG + Intergenic
1076897291 10:133318880-133318902 TGTCAGTTCGGACACTGTGGAGG + Intronic
1077885415 11:6383871-6383893 AGTTTTTTAGGATAATTTGGTGG - Intergenic
1079613090 11:22457310-22457332 AGTTATTAAGTACAATTTGGTGG - Intergenic
1080086197 11:28285556-28285578 TGTTACTTAAAACACTTTGATGG - Intronic
1080315171 11:30939199-30939221 TGTTATTCAGGAGACAGTGGAGG - Intronic
1081185073 11:40032474-40032496 TGTTTTTAAGGATAGTTTGGAGG + Intergenic
1082692051 11:56318026-56318048 TTTTATTTATCACAATTTGGAGG - Intergenic
1084175515 11:67420469-67420491 TGCAATTTAAGACACGTTGGAGG + Intronic
1085359080 11:75869649-75869671 TGTTATTTATGTTAGTTTGGAGG + Intronic
1087527362 11:99333283-99333305 TGTGATTTAGGTGACTTTTGGGG + Intronic
1087907766 11:103719239-103719261 GGTTATTTAAGTCACTTTGTAGG + Intergenic
1088049092 11:105489078-105489100 TGGTATTTAGGATACTTTGGGGG + Intergenic
1088312123 11:108471091-108471113 GGTTTTTAAGGACAATTTGGTGG + Intergenic
1088689393 11:112312217-112312239 CTTTATTTTGCACACTTTGGGGG + Intergenic
1095622551 12:44275367-44275389 TGTTATGGAGAACAGTTTGGAGG + Intronic
1095887672 12:47205958-47205980 AGTTTTTAAGGACAATTTGGTGG + Intronic
1097340649 12:58434070-58434092 GGTTTTTAAGGACAATTTGGTGG + Intergenic
1098216696 12:68228035-68228057 TGTTATTTAGGACACTTTGGGGG - Intergenic
1098408620 12:70154148-70154170 AGTTTTTAAGGACAATTTGGTGG + Intergenic
1098958523 12:76713424-76713446 TGTTATTTGGGTTACTTTAGGGG + Intergenic
1099046267 12:77724440-77724462 ACATATTTAGGCCACTTTGGGGG + Intergenic
1100247060 12:92769132-92769154 TGTTACTTAAGACACTTGGGGGG - Intronic
1102740763 12:115205575-115205597 TGTTTTTAAGGATAATTTGGAGG - Intergenic
1108192642 13:47957879-47957901 TGTCAGTTTGGACACTTTTGGGG + Intronic
1111295150 13:86268355-86268377 TGTTATTTGGGAGAGTTTTGAGG - Intergenic
1111476970 13:88762239-88762261 TGTTTTTAAGGATAATTTGGTGG - Intergenic
1112818799 13:103306464-103306486 TGATATTTAGGAGACTTTCTCGG + Intergenic
1113113143 13:106846127-106846149 TGATTTTTAGGACATTTTGAGGG + Intergenic
1115904024 14:38187004-38187026 TGTTATTTATGACAGGGTGGTGG + Intergenic
1116642936 14:47487839-47487861 TGTTATAATGGACATTTTGGGGG - Intronic
1120337809 14:83180532-83180554 TGTTATTTAGGAAATTTCAGGGG + Intergenic
1123736153 15:23185366-23185388 TGTTATTTACAACTATTTGGGGG + Intergenic
1123777806 15:23597938-23597960 TTTCAGTTTGGACACTTTGGAGG - Intronic
1123842992 15:24268301-24268323 TGTTTTTAAGGATAATTTGGTGG - Intergenic
1124295840 15:28503297-28503319 TGTTATTTACAACTATTTGGGGG - Intergenic
1125297863 15:38222191-38222213 TGTTCTCTAGCACACTTTGATGG - Intergenic
1125328223 15:38558620-38558642 TGTTTTTTAGCACACATTGCTGG - Intronic
1127251896 15:57247361-57247383 TATTATGGAGGAAACTTTGGAGG - Intronic
1127275256 15:57438155-57438177 TGTTATTCAGGACAATATAGGGG - Exonic
1128864518 15:71104215-71104237 TGTTTTTTATGAAACTTTGCAGG - Intronic
1129793102 15:78354966-78354988 TATTTTATAGGACACTTTGCTGG - Intergenic
1129926784 15:79371560-79371582 AGTTTTTAAGGATACTTTGGTGG + Intronic
1130214216 15:81953164-81953186 TGTAATTCAGGACACTGTTGTGG - Intergenic
1133268916 16:4600990-4601012 TGTAATTTCAGCCACTTTGGAGG + Intergenic
1135123600 16:19787387-19787409 TGTTATTTGGGAGAGTTTTGAGG + Intronic
1138360328 16:56422810-56422832 TGTTATTTTGGGCACTTTGGAGG - Intronic
1138495866 16:57408995-57409017 TGTTTATTAGGCCAGTTTGGTGG - Intronic
1140616926 16:76676339-76676361 GGTTATTAAGGATAATTTGGTGG + Intergenic
1141753042 16:85972204-85972226 AGTTTTTAAGGACAATTTGGTGG - Intergenic
1143605455 17:7982284-7982306 AGTTTTTAAGGACAATTTGGTGG + Intergenic
1144303780 17:13948750-13948772 TATTATTCAGGACTCTTTTGGGG - Intergenic
1144383616 17:14728000-14728022 TGTTATTTTGGAAACTAAGGAGG + Intergenic
1145856043 17:28158740-28158762 AGTTATTGAGGACACTGAGGTGG - Intronic
1145897628 17:28469642-28469664 TGATATCTAGGGCACTTTGCAGG + Intronic
1146949359 17:36894906-36894928 AGTTCTTCAGGACTCTTTGGCGG - Intergenic
1148342531 17:46881979-46882001 TGTTATAAAGGACATTTTGAGGG - Intronic
1149965793 17:61162847-61162869 TGTTATTTGGGACACTCAAGAGG + Intronic
1150106450 17:62465830-62465852 AGCTATATAGGACATTTTGGGGG + Intronic
1151874130 17:76856913-76856935 TGCTGTTTGGGACACTTGGGAGG + Intergenic
1153602865 18:6798811-6798833 TTTTATTTAAATCACTTTGGTGG - Intronic
1155220886 18:23684590-23684612 TGAGAATGAGGACACTTTGGTGG - Intergenic
1155447651 18:25928900-25928922 TGTGCTTCAGGTCACTTTGGGGG - Intergenic
1156160600 18:34353690-34353712 AGTTCTTTAGGGAACTTTGGTGG + Intergenic
1160114325 18:76063570-76063592 TGCTATTTGGGGCACTTTGGTGG - Intergenic
1161690595 19:5731113-5731135 TTTGGTTTAGGACAATTTGGGGG - Intronic
1161706288 19:5823665-5823687 TGGTGTTTAGGACAGTCTGGAGG - Intergenic
1163927541 19:20360409-20360431 TTTTATTTATAACAATTTGGGGG + Intergenic
1164829101 19:31307073-31307095 TGTTATTTACAAGGCTTTGGTGG - Intronic
1165579279 19:36848438-36848460 TGTTTTTTAGGAGACATTGGTGG + Intronic
1165637261 19:37351309-37351331 TGTGATTTAAAACATTTTGGGGG + Intronic
1165999577 19:39870447-39870469 GGTTATCCAGGACCCTTTGGAGG - Intronic
1166946118 19:46397531-46397553 TTTTATTCTGGACATTTTGGGGG + Intergenic
1168489181 19:56793674-56793696 TTTCATTTTGGACATTTTGGAGG - Intronic
926435128 2:12829322-12829344 TTTTATTTAGCACACATTTGTGG - Intergenic
928486637 2:31738822-31738844 TGATATGGAAGACACTTTGGAGG + Intergenic
929831003 2:45346132-45346154 TGCAATTTAGAACACTTGGGAGG - Intergenic
931938359 2:67223574-67223596 TGTCAGTTAGGGCACTTTAGGGG - Intergenic
933073257 2:77889282-77889304 TGTTTTTAAGGATAATTTGGAGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
936079623 2:109423418-109423440 TGTTATTGAGGATGGTTTGGTGG - Intronic
937191634 2:120107043-120107065 TGTTATTTATAACACTTGGTTGG + Intronic
937520416 2:122707070-122707092 TTTTTTTAAGGACAGTTTGGTGG - Intergenic
939513465 2:143136606-143136628 TGTTATTAAGTATACTTTGAGGG + Intronic
939920883 2:148111520-148111542 GGTTGTCTAGGACACTTTGCAGG + Intronic
940390875 2:153131204-153131226 AGTTATTTATGATAATTTGGAGG - Intergenic
941582721 2:167319097-167319119 TGGTTTTTAGGACTCTTTGTGGG + Intergenic
941651334 2:168095424-168095446 TGTTCTTTAGACCTCTTTGGAGG - Intronic
942001975 2:171656749-171656771 TATTATGGAGAACACTTTGGGGG + Intergenic
943952824 2:194152510-194152532 TGTTATTTAGGATACTTCACAGG - Intergenic
945078410 2:206063727-206063749 TGTTATTTAGTTCAATTTGGGGG - Intronic
945117250 2:206420039-206420061 TGTCATATATGACACTGTGGAGG - Intergenic
946138218 2:217665671-217665693 TGTTATTAATGACATTTGGGAGG - Intronic
947912858 2:233812901-233812923 TGTAATACAAGACACTTTGGGGG + Intronic
1169060059 20:2654601-2654623 TGTTATCCTGGACATTTTGGGGG + Intronic
1169360373 20:4943560-4943582 AGTTATTTAGGAGACTGAGGTGG + Intronic
1170587416 20:17745299-17745321 TGGTGTTTAGAACACTCTGGAGG + Intergenic
1171216645 20:23357136-23357158 TGCTAATTTGGACAATTTGGGGG + Intergenic
1173043466 20:39487792-39487814 TGATATTTAGGACGTTTTTGGGG - Intergenic
1173377572 20:42501254-42501276 TGTTACTTAAAACACTGTGGTGG - Intronic
1174162442 20:48561221-48561243 AGTTAATTAGAACACTCTGGTGG - Intergenic
1174268484 20:49349352-49349374 TGTTATGTGGCACACATTGGTGG + Intergenic
1176206128 20:63889079-63889101 TGTTGTTAGGGACCCTTTGGAGG + Intronic
1177045022 21:16158368-16158390 ATTTATTTAGGACCCTTTTGGGG - Intergenic
1177887301 21:26762164-26762186 TGTTTTTATGGACAATTTGGTGG + Intergenic
1178114677 21:29405058-29405080 TGTCATTTGGAACAGTTTGGAGG + Intronic
1178686970 21:34719578-34719600 TGTTCTTAAGGAAAGTTTGGAGG - Intergenic
1178752058 21:35314247-35314269 TGTTCCTAGGGACACTTTGGGGG - Intronic
1179892075 21:44340604-44340626 TGTTTTTAAGGATAATTTGGCGG - Intergenic
1180196322 21:46196575-46196597 TTTTATTTAGTTCACTTTGTTGG - Intronic
1181644188 22:24221866-24221888 TGTTTTTAAGGACAACTTGGCGG - Intronic
1182335687 22:29581871-29581893 TTTTATTAAGGATAATTTGGTGG + Intergenic
1182508131 22:30800178-30800200 TGGTATTGTGGACACTTTGCTGG + Intronic
1182864005 22:33586225-33586247 TTTTACTTAGGTCATTTTGGAGG - Intronic
1183224388 22:36539427-36539449 TCAAATTTGGGACACTTTGGGGG + Intergenic
950935771 3:16837503-16837525 AGTTTTTAAGGACAATTTGGCGG - Intronic
952442622 3:33347590-33347612 TGTTATGAAGAACAGTTTGGAGG - Intronic
955216239 3:56986909-56986931 TGATGTTTAAAACACTTTGGAGG + Intronic
957470800 3:80654993-80655015 TGTTATTTAACATCCTTTGGTGG - Intergenic
960004719 3:112770315-112770337 AGTTTTTTAGGACAATTTGGTGG - Intronic
960006602 3:112787516-112787538 AGTTTTTAAGGACAATTTGGTGG - Intronic
960117944 3:113916395-113916417 TGTTATATAGGATTCTTTTGTGG - Intronic
960456306 3:117877077-117877099 TTTTATTTTAGACATTTTGGTGG - Intergenic
961734982 3:128995629-128995651 TGTGATCTAGGAACCTTTGGAGG - Intronic
963026621 3:140925578-140925600 TGTTAATTAGGAGACATTGGTGG + Intergenic
967137225 3:186522610-186522632 TATTTATTAGGACTCTTTGGAGG - Intergenic
968210467 3:196844527-196844549 TGTTTTTAAGGATAATTTGGTGG + Intergenic
970072015 4:12170862-12170884 TATAATTTAACACACTTTGGTGG - Intergenic
970079999 4:12271504-12271526 AGTTATTTTGGAAACTTTGGAGG - Intergenic
970650006 4:18167223-18167245 AGTTTTTAAGGACAATTTGGTGG - Intergenic
971682454 4:29717980-29718002 TATTGTTTAGAACAATTTGGAGG - Intergenic
972411946 4:38803909-38803931 TCTTCTTTTGGAGACTTTGGAGG + Intronic
972871469 4:43305019-43305041 TACTATTGAGGACAGTTTGGAGG + Intergenic
974890185 4:67872209-67872231 TTTTATTTTGGCCATTTTGGGGG - Intronic
975431289 4:74294351-74294373 TCTTATTTAAGATACTTTGTTGG - Intronic
976205073 4:82616762-82616784 TATTATTTAAGCCACTTTGCTGG + Intergenic
977627428 4:99202752-99202774 TGTTAGTAAGGTCAATTTGGGGG + Exonic
977956102 4:103027886-103027908 TTTCATTTAGGAGGCTTTGGGGG - Intronic
979979669 4:127238899-127238921 TGTTTCTTAGGAAAATTTGGGGG - Intergenic
981551469 4:145945861-145945883 TGTTATTTTGGGCAATTTGTAGG - Intergenic
981980438 4:150785103-150785125 TGTTTTTCAGGATAATTTGGTGG + Intronic
982521217 4:156418535-156418557 TGTTATTAAGGCCACTTTGTGGG + Intergenic
982969716 4:161969304-161969326 TGTTATTTTCAACACTTGGGTGG - Intronic
989806684 5:45616909-45616931 AGGTATTTAGGACACATTTGCGG - Intronic
990421774 5:55642477-55642499 TGTTATTAGGGAGACTTTGGTGG + Intronic
990622911 5:57579423-57579445 TGTGATTTAGGACCCTCTAGGGG + Intergenic
990747498 5:58974987-58975009 GGATATTTTGGACACTTTGGAGG - Exonic
991013036 5:61903675-61903697 TGTTAAATAAGACACCTTGGAGG - Intergenic
993260164 5:85647543-85647565 TGTTATTCAGGAGACGGTGGAGG - Intergenic
993852401 5:93026752-93026774 TGTTATGGAGAACATTTTGGAGG + Intergenic
996132254 5:119795783-119795805 TGTTTTTAAGGACAACTTGGTGG + Intergenic
996716613 5:126593167-126593189 TGTCATTTAGGACTGTCTGGGGG - Intronic
997125107 5:131218357-131218379 TGTTATTTTAGTCATTTTGGGGG - Intergenic
998865328 5:146494172-146494194 TGTTATAAAAGACATTTTGGGGG + Intronic
1000116207 5:158155907-158155929 TGTCAATTAGGTCTCTTTGGTGG - Intergenic
1000231153 5:159316493-159316515 TGTTATGTAGGACACTGTGCTGG - Intronic
1001040063 5:168328199-168328221 TGTTATTATGCACACTTTGTGGG - Intronic
1001646783 5:173288053-173288075 TGTAACTTTGGGCACTTTGGGGG - Intergenic
1001881910 5:175251947-175251969 CGTTCCTTAGGACATTTTGGGGG - Intergenic
1003985796 6:11433863-11433885 TGTCATTTACTACTCTTTGGTGG - Intergenic
1004906729 6:20243669-20243691 GGTTTTTAAGGACAGTTTGGTGG + Intergenic
1012413589 6:98988090-98988112 TGCTCTTTAGGAGACTTTGCAGG - Intergenic
1014055164 6:117005995-117006017 AGTTCATTAGGACACTTTGAAGG + Intergenic
1015598140 6:134886022-134886044 TGATTTTTAGGACACTTTTAAGG - Intergenic
1015825817 6:137310374-137310396 TGCTAGTTTGGCCACTTTGGGGG + Intergenic
1016224077 6:141712427-141712449 TGTTATTTAGTACATTTTCTAGG + Intergenic
1017389076 6:153918767-153918789 TGTTACTTAGGACACATTAAAGG + Intergenic
1017795914 6:157844291-157844313 AGTTTTTAAGGACAATTTGGTGG + Intronic
1020526353 7:9264144-9264166 TTTTATTTTTGACACTTTAGTGG + Intergenic
1020895345 7:13932292-13932314 TGTTAATTAGGACATTGTTGAGG - Intronic
1021066746 7:16184947-16184969 TGTTGTTTTGGACATTTTTGTGG + Intronic
1021775654 7:24052732-24052754 TGTTATTAAGGGCATTTTAGTGG + Intergenic
1023272630 7:38481182-38481204 TGATATTTGGGAAACTTGGGGGG + Intronic
1026409044 7:70100279-70100301 TGTGCTTTAGGACACTTTTCTGG + Intronic
1026657102 7:72266308-72266330 TATTATTTCAGACACATTGGTGG - Intronic
1028334172 7:89630398-89630420 TGTCATTTAGAACAATATGGAGG + Intergenic
1028505834 7:91569296-91569318 TGTAATTTGGGTCACCTTGGAGG - Intergenic
1028861192 7:95652540-95652562 TGTTGTGCAGGACAATTTGGTGG - Intergenic
1029030402 7:97460764-97460786 AGTTTTTAAGGACAATTTGGTGG - Intergenic
1030516195 7:110541378-110541400 GGGTAATTAAGACACTTTGGTGG - Intergenic
1032035510 7:128518403-128518425 AGCTATATAGGACATTTTGGGGG + Intergenic
1032233049 7:130093031-130093053 TGTTATTTGGGAGATTTTAGGGG + Intronic
1033899814 7:146122996-146123018 TCTTCTTTAGTTCACTTTGGAGG + Intronic
1034067640 7:148152265-148152287 GGTTTTTAAGGACAATTTGGTGG + Intronic
1034875773 7:154723759-154723781 TGTCATTTAAGAGACTATGGAGG - Intronic
1035811548 8:2495726-2495748 AGTTTTTAAGGACAATTTGGTGG + Intergenic
1037670299 8:21009692-21009714 GGTTTTTAAGGACAATTTGGTGG - Intergenic
1040074737 8:43218260-43218282 TGGTTTTTGGAACACTTTGGAGG - Intergenic
1042828877 8:73005743-73005765 TGTTTTTAAGGATAATTTGGTGG - Intergenic
1043853973 8:85244376-85244398 AGTTTTTAAGGACAATTTGGTGG - Intronic
1050548547 9:6729426-6729448 AGTTACTTAGGAGGCTTTGGTGG + Intronic
1050586051 9:7112465-7112487 TGATTATGAGGACACTTTGGAGG + Intergenic
1051974672 9:22935095-22935117 GGTTTTTAAGGACAATTTGGTGG - Intergenic
1052330858 9:27266411-27266433 TCTTATGTATGACACTTTAGGGG - Intergenic
1053441230 9:38118017-38118039 TGGGGTTTAGGAGACTTTGGAGG + Intergenic
1053451112 9:38194872-38194894 AGTTTTTAAGGACAATTTGGTGG - Intergenic
1056819135 9:89824696-89824718 TGTTTTTGACAACACTTTGGTGG - Intergenic
1058449204 9:105080488-105080510 GGTGATTTAGGGCAGTTTGGAGG - Intergenic
1060091082 9:120744111-120744133 TGTTATTTTTCACAATTTGGCGG - Intergenic
1060569242 9:124623048-124623070 TCTTATTTGGCACACTGTGGAGG - Intronic
1186680075 X:11863456-11863478 ATTTTTTTAGGAGACTTTGGTGG + Intergenic
1188686485 X:33076230-33076252 GGTTTTTAAGGACAATTTGGTGG - Intronic
1192161578 X:68792425-68792447 TGTTTTTAAGGATAATTTGGTGG - Intergenic
1192814661 X:74578060-74578082 TGTTATTCATAACAATTTGGGGG - Intergenic
1194808793 X:98364567-98364589 AGTTTTTAAGGACAATTTGGTGG - Intergenic
1196648565 X:118145638-118145660 TGTTATTGAGGTCACTATGGTGG - Intergenic
1197334266 X:125192856-125192878 TGTTATTTAAGGCACTATGTTGG + Intergenic
1198214385 X:134543789-134543811 TTCTATTTGGGACACTTGGGTGG + Intergenic