ID: 1098217687

View in Genome Browser
Species Human (GRCh38)
Location 12:68237351-68237373
Sequence TGATCTTTTGGAGGACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098217687_1098217690 -4 Left 1098217687 12:68237351-68237373 CCTTCTTGTCCTCCAAAAGATCA No data
Right 1098217690 12:68237370-68237392 ATCAGCTTAAATGCAACCTTCGG No data
1098217687_1098217695 28 Left 1098217687 12:68237351-68237373 CCTTCTTGTCCTCCAAAAGATCA No data
Right 1098217695 12:68237402-68237424 AATGATGATTGTCATCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098217687 Original CRISPR TGATCTTTTGGAGGACAAGA AGG (reversed) Intergenic
No off target data available for this crispr