ID: 1098218416

View in Genome Browser
Species Human (GRCh38)
Location 12:68243581-68243603
Sequence TGGTTACAAAGTCCCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098218416_1098218423 26 Left 1098218416 12:68243581-68243603 CCCAAGGAGGGACTTTGTAACCA 0: 1
1: 0
2: 3
3: 12
4: 149
Right 1098218423 12:68243630-68243652 CAGTATAATTTGCATAAATAAGG 0: 1
1: 0
2: 3
3: 22
4: 255
1098218416_1098218424 27 Left 1098218416 12:68243581-68243603 CCCAAGGAGGGACTTTGTAACCA 0: 1
1: 0
2: 3
3: 12
4: 149
Right 1098218424 12:68243631-68243653 AGTATAATTTGCATAAATAAGGG 0: 1
1: 1
2: 1
3: 46
4: 491
1098218416_1098218425 28 Left 1098218416 12:68243581-68243603 CCCAAGGAGGGACTTTGTAACCA 0: 1
1: 0
2: 3
3: 12
4: 149
Right 1098218425 12:68243632-68243654 GTATAATTTGCATAAATAAGGGG 0: 1
1: 0
2: 1
3: 34
4: 287
1098218416_1098218421 -1 Left 1098218416 12:68243581-68243603 CCCAAGGAGGGACTTTGTAACCA 0: 1
1: 0
2: 3
3: 12
4: 149
Right 1098218421 12:68243603-68243625 AGGCATAGGCGTGATCAGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098218416 Original CRISPR TGGTTACAAAGTCCCTCCTT GGG (reversed) Intergenic
904034913 1:27553382-27553404 TAGTTATAAAGTACCTACTTTGG + Intronic
907917608 1:58885326-58885348 AGGGTGCAAAGACCCTCCTTGGG - Intergenic
909415450 1:75401144-75401166 TGGTTATAAACTCACTACTTAGG + Intronic
911334672 1:96567788-96567810 TTGTTACAAAGTCCCTGCTTTGG - Intergenic
912380962 1:109248103-109248125 TGGTCACACAGACACTCCTTGGG + Intergenic
913234834 1:116770837-116770859 TGGGTTCAAAGTCCTTCCTCTGG - Intergenic
915477675 1:156162613-156162635 TGGTTACACTGTCCCTCCAATGG + Intronic
916760768 1:167815339-167815361 TGGTTACATAGTTTCTCCTGAGG - Intronic
918367753 1:183826819-183826841 TGTTTAAAGGGTCCCTCCTTGGG + Intronic
918681683 1:187362919-187362941 TGATTACAAAGTCCCACAATAGG - Intergenic
922820968 1:228485461-228485483 TGGTTACAATGTTCCTAATTTGG + Intergenic
924895245 1:248331441-248331463 TGGTTACAAGGTCCCACAGTCGG + Intergenic
1063672179 10:8107979-8108001 AAGTCACAAATTCCCTCCTTAGG - Intergenic
1063963378 10:11325768-11325790 AGTTTCCAAAGTCCCTTCTTAGG - Intronic
1070838231 10:79464792-79464814 TGGTCACTAAGTCCTCCCTTGGG - Intergenic
1072765176 10:98089115-98089137 TGGCTACAAAGGCCCTTCCTGGG - Intergenic
1073491986 10:103858689-103858711 TGGTCACAAAGACCCTACATGGG - Intergenic
1080796817 11:35571912-35571934 TTGTTATAAATTCCCTCCCTGGG - Intergenic
1086156926 11:83677768-83677790 TGGAGACAAAGACCCTCCTAAGG - Intronic
1086957222 11:92945934-92945956 TGGTCACTCTGTCCCTCCTTTGG - Intergenic
1087385902 11:97468051-97468073 TTGTTCAAAAGTACCTCCTTGGG + Intergenic
1090641905 11:128736945-128736967 TTGTTAGAATGTGCCTCCTTTGG - Intronic
1091244423 11:134079753-134079775 TGCCTACAAAGTCACTCCTTTGG - Intronic
1092465417 12:8727535-8727557 TGGATACAAAGTGCCTACTTTGG - Intronic
1093314116 12:17627463-17627485 TGGGTTCAAACTTCCTCCTTTGG + Intergenic
1094237769 12:28188274-28188296 TGTTTTCAAAGTCCCTTCATCGG - Intronic
1095493851 12:42763970-42763992 TAGTCACAAAGGCCCTCCCTAGG + Intergenic
1098218416 12:68243581-68243603 TGGTTACAAAGTCCCTCCTTGGG - Intergenic
1098596645 12:72280103-72280125 TGGTTCCACAGTCCCTGCATAGG - Intronic
1098749428 12:74276108-74276130 TGATTACAAAGTCCCACAATAGG - Intergenic
1100850069 12:98700732-98700754 TGGTTACAAAGTTTCTGTTTAGG - Intronic
1101142075 12:101806431-101806453 TGGTTACAAAGTTCCTGTTTGGG + Intronic
1103676022 12:122656359-122656381 TGTTTTCAAAGTTCCTCCATGGG + Intergenic
1104099441 12:125592474-125592496 TGGAAACAAAGTCCTTCCCTGGG - Intronic
1105946564 13:25195535-25195557 CTGTTACAAAGTGCTTCCTTTGG + Intergenic
1107242274 13:38250782-38250804 TTGATAAAAAGTCCTTCCTTTGG - Intergenic
1107855153 13:44607895-44607917 TTGTTACAAATTCATTCCTTTGG + Intergenic
1109577043 13:64272878-64272900 TGGTTAAATAGTCACTCCTGAGG + Intergenic
1109777950 13:67067560-67067582 TGGTTACAGAGTGTCTACTTTGG - Intronic
1111112029 13:83724616-83724638 TGGTTACAAAATAGCACCTTTGG - Intergenic
1111793870 13:92892422-92892444 TGTTTACCAATTCCCTCCTGAGG + Intergenic
1111825181 13:93258635-93258657 TGGTTAAAAATTACCTCCATGGG + Intronic
1111829582 13:93310435-93310457 TGTTTCCAAAGTGCCTCCTGAGG - Intronic
1115675653 14:35670462-35670484 TGGTTACTCATTCCTTCCTTAGG + Intronic
1117667587 14:58072990-58073012 TGGCTACAGCGCCCCTCCTTGGG + Intronic
1118222109 14:63864424-63864446 TGGTTACAAAGACTCTCTGTTGG + Intronic
1123839088 15:24228052-24228074 TGCTAGCAAAGTCCCTCCCTTGG - Intergenic
1128934358 15:71732744-71732766 TGGTCACACAGGCCCTCCTCAGG - Intronic
1130739226 15:86580144-86580166 ATGTTAGAAAGTCCCTCCTACGG - Intronic
1133495301 16:6312074-6312096 TGGGTACAAAATCCCAACTTAGG + Intronic
1137487402 16:48903137-48903159 TGGGTAAAAAGCCCCGCCTTTGG + Intergenic
1138089166 16:54160204-54160226 TGGTTACAGAGTCTCTATTTGGG - Intergenic
1143710848 17:8734364-8734386 TGCTTACAAACGCCCTCCTTTGG + Intronic
1144157737 17:12523229-12523251 TGGTTAGAATGTCCTGCCTTGGG - Intergenic
1145825719 17:27875932-27875954 TGATTACAAAATCGCCCCTTTGG + Intronic
1148503322 17:48107945-48107967 TGGTAAGAGAGTCCCTCCCTAGG - Intronic
1150685900 17:67320733-67320755 TGGTTACAGAGTTCCTGTTTGGG + Intergenic
1152507436 17:80759416-80759438 TGATTTCAAAGTCCCTCTTATGG - Intronic
1152650716 17:81491373-81491395 TGATTACACAGACCCTCCCTTGG - Intergenic
1156479841 18:37429236-37429258 TGGTTACAAGGACCCTCTATGGG + Intronic
1156982304 18:43305095-43305117 TGGTGACATAGTCCCACATTGGG - Intergenic
1157681137 18:49607986-49608008 TGGTTTCTATGACCCTCCTTGGG + Intergenic
1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG + Intronic
1157769649 18:50334663-50334685 TGGTTACAAGGTCCCTCCTCAGG - Intergenic
1157974085 18:52306305-52306327 TGGTTACAAGGTCCCACAATAGG - Intergenic
1158457303 18:57619531-57619553 TGGTTAAAAGTTCCTTCCTTGGG - Intronic
1159471668 18:68865564-68865586 TGCTTGCAAAGTACTTCCTTAGG - Intronic
1160604162 18:80036678-80036700 TGGTATGAAAGTCCTTCCTTGGG + Exonic
1161530419 19:4785625-4785647 TGGTTACAATGTGCTTCCTGGGG + Intergenic
1163049762 19:14673828-14673850 TGGTTACAATGTACATCATTTGG - Intronic
1167725903 19:51212358-51212380 AGGATAGAAACTCCCTCCTTGGG + Intergenic
926090896 2:10048504-10048526 TGCATACATAGTTCCTCCTTCGG - Exonic
926222194 2:10943543-10943565 TGCTTGCAAAGTCTCTCTTTCGG + Intergenic
927031275 2:19122978-19123000 TGGGGACAAATTTCCTCCTTTGG - Intergenic
928189250 2:29146290-29146312 TGATAACCAAGTCCCTCCCTTGG - Intronic
929780936 2:44956431-44956453 TTGTTTCAAAGGCCCTCCTCGGG - Intergenic
931190941 2:59999653-59999675 TGCTTACAAAGTCCAACCCTGGG - Intergenic
937345098 2:121120602-121120624 CGGTGACAAAGGCCCTCTTTTGG + Intergenic
937508665 2:122568105-122568127 TGGTCATAAATTCCCTGCTTAGG - Intergenic
939026828 2:137024071-137024093 TTGTTGAAAAGTCCCTCCTTGGG + Intronic
940087553 2:149877784-149877806 TGGAAACAAAGTTCCTTCTTGGG + Intergenic
943234691 2:185302108-185302130 TGGTTAAATAGTTCCTCCTGAGG + Intergenic
946338849 2:219055916-219055938 TGGTCACAACGACCCTCCCTTGG + Intronic
1172351352 20:34244819-34244841 TTGTTACAAAGTCCACCCTACGG - Intronic
1173079359 20:39850973-39850995 TGGATACAAACAGCCTCCTTGGG - Intergenic
1173411308 20:42812351-42812373 TGGTTACAAAATTTCTCTTTGGG - Intronic
1183660225 22:39215770-39215792 TGATTACAGGGTCCCTTCTTCGG - Intergenic
949310177 3:2688763-2688785 TGGTTACAAAGACCCACGTAGGG - Intronic
951201622 3:19881595-19881617 AGGATACCAAGTTCCTCCTTTGG + Intronic
952916267 3:38246237-38246259 TGGTTTCATGGTCACTCCTTTGG + Intronic
953390194 3:42529560-42529582 TGGTTGGAAAGTCCTTCCTCAGG - Intronic
953668916 3:44946386-44946408 TGGTTATTAAGACCCTACTTAGG - Intronic
956980550 3:74632058-74632080 TGGTTTCAAGGTCCCTTCCTTGG - Intergenic
960324351 3:116276894-116276916 TCATTCCAAAGCCCCTCCTTAGG - Intronic
961375777 3:126464928-126464950 TGGTCATGAAGCCCCTCCTTGGG - Intronic
962182974 3:133227491-133227513 TGGTTAGAAAGGCCTTCCTTAGG - Intronic
963232717 3:142925151-142925173 TGGTTACATAGTTTCTCCTGAGG + Intergenic
963624479 3:147653790-147653812 TGGTTACAAATAGCTTCCTTAGG + Intergenic
964168828 3:153742187-153742209 GGTTCATAAAGTCCCTCCTTTGG + Intergenic
967536980 3:190616472-190616494 TATTTACAAAGTCCCTCCTATGG - Intronic
968236262 3:197031543-197031565 TGATGACTAAGTCCTTCCTTTGG + Intergenic
969474598 4:7414331-7414353 TATTTCCAAAGTCCCTCCTAGGG - Intronic
974502203 4:62721030-62721052 TGTTTACAAAATCACTTCTTGGG - Intergenic
977299990 4:95256746-95256768 TGATTACAAAGTCCCACGATAGG + Intronic
979378312 4:119976459-119976481 TTATTACAAATTCCCTCTTTTGG - Intergenic
981867060 4:149435025-149435047 TGTTTACAAAGTCCACCCATGGG - Intergenic
984130386 4:175867877-175867899 TGGTTAAATAGTTTCTCCTTAGG + Intronic
986111133 5:4718952-4718974 TGGTGACAAAGTCCCTCCCAGGG + Intergenic
986994757 5:13594221-13594243 TGGTGCCAAAGTCCCTGCTGTGG + Intergenic
988488797 5:31689896-31689918 TGGCTTCAAAGTCCTTCCTTAGG + Intronic
988774300 5:34463473-34463495 TGGTCACTCTGTCCCTCCTTTGG - Intergenic
991010534 5:61878384-61878406 TGCTTACCAAGGCTCTCCTTTGG - Intergenic
993444873 5:87999053-87999075 TGGTCTCAAACTCCCTCCTCAGG - Intergenic
993508531 5:88742154-88742176 TGGTTAAAAACCCCCTCTTTTGG - Intronic
994144779 5:96382818-96382840 TAGTCACAAAATCCCTCCCTAGG + Intergenic
996174176 5:120334296-120334318 TTCTTACAAAGCCACTCCTTTGG - Intergenic
1000800093 5:165714897-165714919 TAGTCACAATGTCCTTCCTTGGG - Intergenic
1004260055 6:14100240-14100262 TGGTTGCAAAGTCCTTCAGTAGG + Intergenic
1005998246 6:30945261-30945283 TATTTACAAAGTGCCTCCTATGG + Intronic
1012366405 6:98445866-98445888 TGATTACAAGGTCCCTCAATAGG - Intergenic
1013793916 6:113863385-113863407 TGGTTACAAAATACTTCCTCTGG + Exonic
1014405602 6:121046790-121046812 TGGTCACTCTGTCCCTCCTTTGG + Intergenic
1015141164 6:129933652-129933674 TGGTAAGAAAGCCCCTCCTTTGG + Intergenic
1017216187 6:151909982-151910004 TGGTTACAGCATCCCTTCTTTGG - Intronic
1021075367 7:16297777-16297799 AGGATACAAAATCCCACCTTTGG + Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022379649 7:29847832-29847854 TGGTTTCTATGACCCTCCTTGGG + Intronic
1024358328 7:48442016-48442038 TGTTTACACAGTCTCTCCTCTGG - Intronic
1026058702 7:67007464-67007486 TGGTAACAAAGCCACTCCTGAGG + Intronic
1026556274 7:71411418-71411440 TGGTTAGAAAGTCACCCCCTTGG - Intronic
1033520477 7:142155383-142155405 TGGGTTCAAAGTCCCCCCTAAGG + Intronic
1036980671 8:13466590-13466612 TGTTTACAAGGTGCCTCCATGGG - Intronic
1041095164 8:54342574-54342596 TGGCTACACAGCCCCTTCTTGGG + Intergenic
1042821489 8:72934882-72934904 TGGTTAGAAAATCCCCACTTGGG + Intronic
1042988074 8:74605289-74605311 AGATTACAAAGTTCCTCCCTGGG - Intronic
1043626475 8:82266995-82267017 TGGTTAAAAAATCCATCCCTGGG + Intergenic
1044933318 8:97270826-97270848 TGGTTCTAACGTGCCTCCTTAGG + Intergenic
1048312717 8:133338120-133338142 TGGCCACAAAGACCCTGCTTGGG + Intergenic
1048544214 8:135371162-135371184 TGGCTACCAGGTCTCTCCTTGGG - Intergenic
1048947111 8:139459640-139459662 TGTTTACACAGTGCCTCTTTCGG - Intergenic
1049245707 8:141561212-141561234 CTGTGAGAAAGTCCCTCCTTGGG + Intergenic
1049276644 8:141723408-141723430 TGGCTACCAAGACCCTGCTTGGG - Intergenic
1051056982 9:12999719-12999741 TGGTCTCAAACTCCCGCCTTAGG - Intergenic
1053534597 9:38913227-38913249 TGGTCCCAAAGTCCATCCTAGGG + Intergenic
1054206816 9:62137647-62137669 TGGTCCCAAAGTCCATCCTAGGG + Intergenic
1054631536 9:67450700-67450722 TGGTCCCAAAGTCCATCCTAGGG - Intergenic
1055099087 9:72444776-72444798 TGCTTACAAATTCCCTTTTTTGG - Intergenic
1055241175 9:74188303-74188325 TGATTAAAAAGACCCTCCTCAGG - Intergenic
1057768348 9:97943553-97943575 TTGTCCCAAAGTCCCTCCTCTGG + Intronic
1058595061 9:106606175-106606197 TGGGTTCAAACTTCCTCCTTTGG - Intergenic
1058778480 9:108309576-108309598 TGTTTACAAAGTACCTTCCTCGG + Intergenic
1060018487 9:120107921-120107943 TGGTTTCAATGTCCTTTCTTTGG + Intergenic
1061484924 9:130915335-130915357 TGGTTTCAGTGTCCTTCCTTGGG - Intronic
1061932366 9:133839811-133839833 TGTTTACAAAGTCCCTACTGAGG - Intronic
1062419028 9:136470257-136470279 TGGTGACAAAGCCACTCCTGTGG + Intronic
1062703216 9:137919023-137919045 TGGTCACACAGTCCTTCATTTGG - Intronic
1185558198 X:1037804-1037826 TGATCACAAGGTCCCACCTTAGG - Intergenic
1188278417 X:28231706-28231728 TGGGTACAAAGTCTCTTTTTGGG - Intergenic
1188451724 X:30314402-30314424 TAGTTAGAAACTCCCTGCTTTGG + Intergenic
1190478898 X:50855298-50855320 TGCTTACAGAGTACCTACTTGGG - Intergenic
1197217743 X:123882270-123882292 TTGTTATAAAGCCCATCCTTGGG + Intronic
1197820555 X:130536965-130536987 TGGTTACGAGCTCCCTCCTCAGG + Intergenic
1198327268 X:135586284-135586306 TGGTTACAGAGTCTCTGTTTAGG + Intergenic
1198523604 X:137476555-137476577 TGCTTTCAAAGTCCCTCCTGTGG + Intergenic
1199309864 X:146310000-146310022 TGGTTACAATGTCCCCTCCTTGG - Intergenic