ID: 1098226811

View in Genome Browser
Species Human (GRCh38)
Location 12:68332559-68332581
Sequence CCAATAAGGCTCCCGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098226796_1098226811 24 Left 1098226796 12:68332512-68332534 CCTTGCCAAATCCCTGGGGCTGA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1098226800_1098226811 12 Left 1098226800 12:68332524-68332546 CCTGGGGCTGATAGAGATGGCGG 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1098226799_1098226811 13 Left 1098226799 12:68332523-68332545 CCCTGGGGCTGATAGAGATGGCG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1098226795_1098226811 25 Left 1098226795 12:68332511-68332533 CCCTTGCCAAATCCCTGGGGCTG 0: 1
1: 0
2: 2
3: 24
4: 228
Right 1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1098226797_1098226811 19 Left 1098226797 12:68332517-68332539 CCAAATCCCTGGGGCTGATAGAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1098226793_1098226811 28 Left 1098226793 12:68332508-68332530 CCTCCCTTGCCAAATCCCTGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
Right 1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098226811 Original CRISPR CCAATAAGGCTCCCGGAACC GGG Intergenic
901080345 1:6580398-6580420 CCAATATGGCCCCCGGCCCCCGG + Intronic
901635871 1:10669861-10669883 CCCATAAAGCACCCGGAGCCTGG - Intronic
915325829 1:155080753-155080775 GAAAGGAGGCTCCCGGAACCCGG - Intronic
920857247 1:209673265-209673287 CCAATATAGCTGCTGGAACCTGG + Intergenic
922019995 1:221694156-221694178 TCAATAGGGCTCCTGGCACCTGG + Intergenic
1072898543 10:99387914-99387936 CCACTAAGGCCCCCACAACCCGG + Exonic
1073253037 10:102133523-102133545 CCAGTGAGGCTCCCCGAGCCCGG + Intronic
1076692208 10:132229681-132229703 CCAGTAAGGGCCCCGGAGCCAGG - Intronic
1077478010 11:2800060-2800082 CCGATAAGGCTGCTGGGACCTGG + Intronic
1089492432 11:118892390-118892412 CCATTAAGCCACCCGGAGCCTGG + Intronic
1091778982 12:3201962-3201984 CCACTGGGGCTCCCAGAACCTGG - Intronic
1098146839 12:67506176-67506198 CCAACAAGCCTCCCGGAGCTGGG + Intergenic
1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG + Intergenic
1099552871 12:84070477-84070499 CCAGGAAGGCTCCCCGAACAGGG - Intergenic
1102658771 12:114506436-114506458 CCAATAAGTCTCCTGGGATCTGG - Intergenic
1103162271 12:118739452-118739474 CCAAGAATGCTCCAGGAAGCTGG - Intergenic
1113816874 13:113178097-113178119 GCAACAAGGCTCCCTGAAGCCGG - Intronic
1121814281 14:96917082-96917104 CCAAGAAGTCTCCAGGAACATGG - Intronic
1127870867 15:63072668-63072690 CCAAGCAGGGTCCCGGAGCCTGG + Intergenic
1136933488 16:34437797-34437819 CCAAGAAGGGGCCCGGAGCCAGG - Intergenic
1136971084 16:34974017-34974039 CCAAGAAGGGGCCCGGAGCCAGG + Intergenic
1144357252 17:14458084-14458106 CCATTAAGGTTCCTGAAACCAGG - Intergenic
1146591062 17:34128322-34128344 CCTATGAGGCTCCCTGCACCTGG - Intronic
1158864294 18:61623055-61623077 CCAATAAAGCTCCTGGAAACTGG + Intergenic
1160847866 19:1174248-1174270 CCAAGATGGCGCCCGAAACCCGG - Exonic
1163127049 19:15249996-15250018 CCAACATGGCTCCCTGGACCAGG + Intronic
1166351751 19:42202167-42202189 CAAAGAAGGCTCCCAGAAACAGG + Intronic
929439014 2:41950848-41950870 CCAATAAGGCTCCCAGGTCTGGG - Intronic
932752373 2:74379580-74379602 CCAATAAGCCTCTCAGAACCAGG + Intronic
936041374 2:109152453-109152475 CCCATCAGGCACCCGGAACAAGG - Intronic
938280685 2:130061678-130061700 CCAATCAGGCTGTTGGAACCTGG + Intergenic
938280792 2:130062309-130062331 CCAATCAGGCTGTTGGAACCTGG + Intergenic
938331435 2:130451146-130451168 CCACTCAGGCTCTTGGAACCTGG + Intergenic
938331839 2:130453595-130453617 CCACTCAGGCTCTTGGAACCTGG + Intergenic
938358516 2:130670357-130670379 CCACTCAGGCTCTTGGAACCTGG - Intergenic
938435014 2:131277661-131277683 CCACTCAGGCTGCTGGAACCTGG - Intronic
944192478 2:197018286-197018308 CCAATCAGGCCCCCAGAATCTGG + Intronic
944852918 2:203738380-203738402 CCAATAAAGGACCCAGAACCAGG + Exonic
945767180 2:213995636-213995658 AGAATAAGGCTCCAGGAACTTGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946287786 2:218718326-218718348 CCAACAAGTCTCCAGGGACCAGG - Intronic
1175552659 20:59827277-59827299 CCAATCAGCCTCCTGGAGCCGGG - Intronic
1176215900 20:63947625-63947647 CCAATAAGGCTCCCAGCGCAGGG - Intronic
1178496761 21:33092867-33092889 CCAAAAAGCCTCCCAGGACCTGG - Intergenic
1179242014 21:39601061-39601083 ACAATAAAGCTCCAGGAGCCAGG - Intronic
1179597219 21:42451026-42451048 CCAAGAAGGCCCCAGGAGCCTGG + Intergenic
1183925833 22:41205315-41205337 CCAATATGGCTTCCTGCACCTGG + Exonic
950038298 3:9902899-9902921 CAATTAGGGCTCCCGGAACATGG - Exonic
950516969 3:13473331-13473353 CCACCAAGGCTCCAGGCACCGGG + Intergenic
953485438 3:43290028-43290050 ACAAAAATGCTCCAGGAACCTGG + Intronic
968919809 4:3516700-3516722 CCAAGACGGCTCCTGGACCCTGG + Intronic
975624270 4:76328278-76328300 CCAGGAAGGCTCCAGGCACCTGG + Intronic
978443869 4:108762649-108762671 CCAGAAACGCTCCTGGAACCCGG - Intronic
983817474 4:172149961-172149983 TGAATAAGGCTCTCAGAACCTGG + Intronic
988448522 5:31315269-31315291 ACAATAAAGCTCCAGGAAACAGG + Intronic
1007092459 6:39192707-39192729 CCAAGAAGGCTCCCTGCAGCAGG - Intronic
1013111351 6:107067708-107067730 ACCACAAAGCTCCCGGAACCTGG + Exonic
1028722546 7:94050181-94050203 CCAATGTGGCTCCCAGAACCAGG + Intergenic
1029158493 7:98534252-98534274 CCTATAAGGCTGCTGGAAGCTGG + Intergenic
1053184442 9:36003416-36003438 CCCATAAGGCTGCCGGCTCCTGG - Intergenic
1053312565 9:37028687-37028709 CTAATAAGGGTCCCTGAAGCGGG + Intronic
1057913254 9:99036248-99036270 GCGATAATGCTCCCAGAACCAGG - Intronic
1059162942 9:112052172-112052194 CCAAGAAGGCTCCAGGAACTGGG - Intronic
1062009800 9:134260919-134260941 CCATCGAGGCTCCCGGAACAGGG - Intergenic
1062350751 9:136137574-136137596 CCAAGAATGCACCAGGAACCGGG + Intergenic
1189806997 X:44745329-44745351 CCAATGTGGCTCCTGGAACAGGG - Intergenic
1194745211 X:97620698-97620720 CCAACAAGGCTCCTGCACCCTGG + Intergenic