ID: 1098227652

View in Genome Browser
Species Human (GRCh38)
Location 12:68341116-68341138
Sequence CCAAAGGAAGGATGGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098227644_1098227652 8 Left 1098227644 12:68341085-68341107 CCAACAGGACATCTGCTTATGAC No data
Right 1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG No data
1098227642_1098227652 21 Left 1098227642 12:68341072-68341094 CCAGATCCAGGAACCAACAGGAC No data
Right 1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG No data
1098227643_1098227652 15 Left 1098227643 12:68341078-68341100 CCAGGAACCAACAGGACATCTGC No data
Right 1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098227652 Original CRISPR CCAAAGGAAGGATGGGAATT GGG Intergenic
No off target data available for this crispr