ID: 1098229407

View in Genome Browser
Species Human (GRCh38)
Location 12:68357730-68357752
Sequence GCAGCTTACCCAAGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098229407_1098229409 10 Left 1098229407 12:68357730-68357752 CCATGTGATCTTGGGTAAGCTGC No data
Right 1098229409 12:68357763-68357785 CTCAAGTTTCTTCTGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098229407 Original CRISPR GCAGCTTACCCAAGATCACA TGG (reversed) Intergenic
No off target data available for this crispr