ID: 1098231797

View in Genome Browser
Species Human (GRCh38)
Location 12:68378681-68378703
Sequence CTGTGGGAATGGTGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098231797_1098231811 29 Left 1098231797 12:68378681-68378703 CCCTACTCCCACCATTCCCACAG No data
Right 1098231811 12:68378733-68378755 TCAGGTGCTAGATGGGGGCTTGG No data
1098231797_1098231808 24 Left 1098231797 12:68378681-68378703 CCCTACTCCCACCATTCCCACAG No data
Right 1098231808 12:68378728-68378750 TTCCCTCAGGTGCTAGATGGGGG No data
1098231797_1098231805 21 Left 1098231797 12:68378681-68378703 CCCTACTCCCACCATTCCCACAG No data
Right 1098231805 12:68378725-68378747 AATTTCCCTCAGGTGCTAGATGG No data
1098231797_1098231806 22 Left 1098231797 12:68378681-68378703 CCCTACTCCCACCATTCCCACAG No data
Right 1098231806 12:68378726-68378748 ATTTCCCTCAGGTGCTAGATGGG No data
1098231797_1098231804 11 Left 1098231797 12:68378681-68378703 CCCTACTCCCACCATTCCCACAG No data
Right 1098231804 12:68378715-68378737 GCATATATATAATTTCCCTCAGG No data
1098231797_1098231807 23 Left 1098231797 12:68378681-68378703 CCCTACTCCCACCATTCCCACAG No data
Right 1098231807 12:68378727-68378749 TTTCCCTCAGGTGCTAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098231797 Original CRISPR CTGTGGGAATGGTGGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr