ID: 1098231883

View in Genome Browser
Species Human (GRCh38)
Location 12:68379445-68379467
Sequence TTGGCAAATTCGCAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098231883_1098231889 28 Left 1098231883 12:68379445-68379467 CCACCCAGCTGCGAATTTGCCAA No data
Right 1098231889 12:68379496-68379518 CAAAGACACAAAATTGAAGTTGG No data
1098231883_1098231887 -7 Left 1098231883 12:68379445-68379467 CCACCCAGCTGCGAATTTGCCAA No data
Right 1098231887 12:68379461-68379483 TTGCCAACAGTTTAAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098231883 Original CRISPR TTGGCAAATTCGCAGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr