ID: 1098233288

View in Genome Browser
Species Human (GRCh38)
Location 12:68394761-68394783
Sequence ATATATAAGCTGATGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098233277_1098233288 28 Left 1098233277 12:68394710-68394732 CCACTCCAGATGTTACCATTCAT No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data
1098233282_1098233288 4 Left 1098233282 12:68394734-68394756 CCCTGCGTGCCAGGGCCACAAGG No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data
1098233279_1098233288 13 Left 1098233279 12:68394725-68394747 CCATTCATTCCCTGCGTGCCAGG No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data
1098233285_1098233288 -5 Left 1098233285 12:68394743-68394765 CCAGGGCCACAAGGTCTCATATA No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data
1098233284_1098233288 3 Left 1098233284 12:68394735-68394757 CCTGCGTGCCAGGGCCACAAGGT No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data
1098233278_1098233288 23 Left 1098233278 12:68394715-68394737 CCAGATGTTACCATTCATTCCCT No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data
1098233276_1098233288 29 Left 1098233276 12:68394709-68394731 CCCACTCCAGATGTTACCATTCA No data
Right 1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098233288 Original CRISPR ATATATAAGCTGATGATGGT AGG Intergenic
No off target data available for this crispr