ID: 1098240487

View in Genome Browser
Species Human (GRCh38)
Location 12:68462406-68462428
Sequence CATGGTAAATACTGTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098240487_1098240493 15 Left 1098240487 12:68462406-68462428 CCTTACTCACAGTATTTACCATG No data
Right 1098240493 12:68462444-68462466 AGATTCCCAGATGAATATCTTGG No data
1098240487_1098240490 -9 Left 1098240487 12:68462406-68462428 CCTTACTCACAGTATTTACCATG No data
Right 1098240490 12:68462420-68462442 TTTACCATGTCCTGGGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098240487 Original CRISPR CATGGTAAATACTGTGAGTA AGG (reversed) Intergenic
No off target data available for this crispr