ID: 1098240487 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:68462406-68462428 |
| Sequence | CATGGTAAATACTGTGAGTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098240487_1098240493 | 15 | Left | 1098240487 | 12:68462406-68462428 | CCTTACTCACAGTATTTACCATG | No data | ||
| Right | 1098240493 | 12:68462444-68462466 | AGATTCCCAGATGAATATCTTGG | No data | ||||
| 1098240487_1098240490 | -9 | Left | 1098240487 | 12:68462406-68462428 | CCTTACTCACAGTATTTACCATG | No data | ||
| Right | 1098240490 | 12:68462420-68462442 | TTTACCATGTCCTGGGTAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098240487 | Original CRISPR | CATGGTAAATACTGTGAGTA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||