ID: 1098241773

View in Genome Browser
Species Human (GRCh38)
Location 12:68474592-68474614
Sequence GGATCCTGCTTTGCTGCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098241773 Original CRISPR GGATCCTGCTTTGCTGCATC CGG Intergenic
901614572 1:10528125-10528147 GGATCCTGCCTTGCACCAGCTGG + Intronic
902617709 1:17632907-17632929 GGAGCCTGGTTTGCTGGTTCTGG + Intronic
903371898 1:22841837-22841859 GGATCCTGTTTTAATGCATGCGG + Intronic
903644549 1:24886675-24886697 GGATCCAGGTTTGTTGCCTCTGG + Intergenic
904358500 1:29957199-29957221 GTATGCTGCTTTTCTGCTTCAGG - Intergenic
908834170 1:68211874-68211896 TGATTCTGCCTGGCTGCATCTGG + Intronic
912769924 1:112454010-112454032 GGCTCCTTCTTTGGTGCCTCTGG + Intronic
913288189 1:117246957-117246979 GGATCCTGGTATAATGCATCAGG - Intergenic
914259185 1:145984679-145984701 GGCCCCTGATTTGCTGCCTCTGG + Intergenic
920555426 1:206900707-206900729 GGGTCCTCCTTTGGTCCATCTGG + Intronic
921554111 1:216576241-216576263 GGAAACTGCTTGGCTGCATGTGG + Intronic
922332909 1:224593352-224593374 GCTTGCTGATTTGCTGCATCCGG + Intronic
923018571 1:230145694-230145716 ACGTCCTGCTGTGCTGCATCAGG - Intronic
1063671884 10:8105577-8105599 GGACCCTGCTGTGTTGCCTCGGG - Intergenic
1065638021 10:27751307-27751329 GGATCCTAATTTGCTACAACTGG - Intergenic
1067820220 10:49521786-49521808 GGATCCTGCTTTCCTTCATTTGG - Intronic
1073041156 10:100607612-100607634 GCTTCCTGCTCTGCTGCATCTGG + Intergenic
1075083554 10:119399357-119399379 GCACCTTGCTTCGCTGCATCTGG - Intronic
1075919361 10:126197684-126197706 GGAGCCTGCCTGGCTGCATTTGG + Intronic
1077635014 11:3836438-3836460 GGATCCTACATTGCAGCAGCAGG + Intronic
1086433506 11:86758941-86758963 TGATCCTGCTTTTCTGCAGGAGG + Intergenic
1086931869 11:92702452-92702474 TGATCCTCCTTTTCTTCATCTGG + Intronic
1088021519 11:105125389-105125411 GTACCCTGCTTCTCTGCATCTGG + Intergenic
1089641014 11:119847206-119847228 GGCTCCTGCCATGCTGCATTGGG - Intergenic
1090534350 11:127624420-127624442 GGATTCTGCTTTGTTGCAGCTGG - Intergenic
1092947249 12:13468166-13468188 GGATCCTGATCTGCTGAAGCAGG + Intergenic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1103025700 12:117572043-117572065 GGGTTCTGCTTTGCAGCTTCAGG - Intronic
1103996876 12:124835860-124835882 GGCTCCTGCTTTGCTCCAGCGGG - Intronic
1105005991 12:132720915-132720937 GAAACCTGCAATGCTGCATCTGG + Exonic
1107674222 13:42777743-42777765 GAATACTGCTTGGCTGAATCAGG - Intergenic
1107769771 13:43777188-43777210 GGATTCTGCATAGCAGCATCAGG - Intronic
1109375401 13:61486050-61486072 TTATCCTGCTTTCCTGGATCTGG - Intergenic
1109632754 13:65073738-65073760 TGATCATGCTTTGTTGCAACAGG + Intergenic
1112236134 13:97638969-97638991 GGATCCGGCATGGCTGGATCTGG + Intergenic
1114295387 14:21324703-21324725 GGATATTTCTCTGCTGCATCAGG + Exonic
1114756188 14:25262866-25262888 GGACCCTGACATGCTGCATCTGG + Intergenic
1114767922 14:25395444-25395466 GGATCCTCCCTTGCAGCAACAGG - Intergenic
1117556161 14:56886689-56886711 AGATCCAGCTTTGCTACATTTGG + Intergenic
1119141837 14:72274361-72274383 GGGTCCTGCTTTGTGCCATCAGG + Intronic
1121333159 14:93060558-93060580 GGACCCTGCTCTGCTGCAAAAGG + Intronic
1121716898 14:96082939-96082961 GAATCCTGCTTTGCCACATATGG - Intronic
1123804155 15:23854298-23854320 GGATGCTGTTTTTCTGGATCTGG - Intergenic
1125745303 15:41993637-41993659 GGATCCAGCTTTTCTGCGTCAGG + Intronic
1125932524 15:43610757-43610779 GGATCATGCTGTCCTGCATCTGG + Intronic
1125945622 15:43710229-43710251 GGATCATGCTGTCCTGCATCTGG + Intergenic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1128916609 15:71568405-71568427 GGATTCTATTTTGCTGAATCAGG + Intronic
1128916613 15:71568441-71568463 TGATTCTGTTTTGCTGAATCAGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1134375730 16:13671200-13671222 GGACCCTGCTAAGCTGCACCTGG + Intergenic
1136711241 16:32238904-32238926 GAATGTTGCTTTGCTGCATCAGG - Intergenic
1136756666 16:32690503-32690525 GAATGCTGCTTTGCTGCATCAGG + Intergenic
1136811444 16:33179872-33179894 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1136817920 16:33289952-33289974 GAATGCTGCTTTGCTGCATCAGG - Intronic
1136824484 16:33346481-33346503 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1136829550 16:33445252-33445274 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1137031455 16:35528036-35528058 TGAGAATGCTTTGCTGCATCAGG + Intergenic
1202990022 16_KI270728v1_random:2841-2863 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1203058815 16_KI270728v1_random:950855-950877 GAATGCTGCTTTGCTGCATCAGG + Intergenic
1150183856 17:63158782-63158804 GAACCCTGCTATGCTGCATTTGG - Intronic
1152466432 17:80469300-80469322 GCTTCCTGCTTTGCACCATCTGG - Exonic
1155853364 18:30800515-30800537 AAATCCTGCTGTGCTGCTTCAGG - Intergenic
1157385965 18:47260375-47260397 GGATCCTGCTTTGAAGCAGTGGG + Intergenic
1160155332 18:76429390-76429412 GGAGCGTGGATTGCTGCATCTGG - Intronic
1161951117 19:7468769-7468791 GGTTCCTGCTGTGCGGCCTCTGG - Intronic
1162786131 19:13036134-13036156 GTATCCTGCTTGGCTGCACCTGG + Intronic
1163138931 19:15332982-15333004 GGATCCTCCTTGGCTGCCCCTGG + Intergenic
1163755274 19:19102947-19102969 GGATCCTTCCTTGCTTCTTCCGG + Intronic
1167775237 19:51550320-51550342 TGTTCCTACTTTCCTGCATCTGG + Intergenic
1168406570 19:56113594-56113616 GAATCGTGCTGTTCTGCATCGGG - Intronic
925409991 2:3634462-3634484 GGGCCCTGCTTTGCTGCAGGAGG - Intronic
925719380 2:6812991-6813013 GTTTCCTGCTTTGCTGAGTCAGG - Intergenic
927491795 2:23525845-23525867 GGATCCTGTGTTGCTGCCCCAGG + Intronic
927934677 2:27069684-27069706 GGATCCTGCTCTGCTACACCAGG + Exonic
929332446 2:40699895-40699917 GGATCCTGAGGAGCTGCATCTGG - Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
931991487 2:67794943-67794965 TTGTCCTGCTTTGCTCCATCCGG - Intergenic
937054486 2:118921674-118921696 GGAACCTGCTTTGGTGCGTCCGG - Intergenic
937445387 2:121952995-121953017 GGATGCAGCTCTGCTGCAACAGG + Intergenic
940333554 2:152501552-152501574 GGATTTTGCTTTCCAGCATCAGG - Intronic
940801864 2:158141936-158141958 GAATCCTGGTTGGCTGAATCTGG + Intergenic
946419937 2:219559071-219559093 GAATCCTGCTTAGCCACATCAGG - Intronic
946612497 2:221474475-221474497 GGATCCTGGTTTACTTCATAAGG - Intronic
948873996 2:240817929-240817951 GGATGATGCTTGGCTGGATCAGG - Intronic
949022429 2:241749078-241749100 GGCTCCTGCTCTCCTGCAGCTGG + Intronic
1168840143 20:904821-904843 GGGTCTTGCTTTGTTGCCTCAGG + Intronic
1169905452 20:10598714-10598736 GGATACGCCTTCGCTGCATCAGG + Exonic
1171430423 20:25080028-25080050 AGATTCTGATTTGGTGCATCAGG - Intronic
1172478177 20:35254319-35254341 GAATTCTGCTTAGCTGCCTCAGG - Intronic
1172760490 20:37317914-37317936 GGGTCCTGCTCTGCTGCAGAGGG + Intergenic
1172991273 20:39038754-39038776 GCATCCTTCTGTGCTGCAGCGGG + Exonic
1179066193 21:38026903-38026925 GCATCCTGCTTTTCTGCTGCTGG + Intronic
1180183821 21:46129813-46129835 GAGTCCTTCTTTGCTGCATCAGG + Intronic
1182449697 22:30411955-30411977 GCTTCCTGCCTTGCTCCATCTGG - Intronic
1183276238 22:36900047-36900069 GGTTCCTGCTCCCCTGCATCAGG - Intergenic
1183387465 22:37523326-37523348 GGTGCTTGCTTTGCTGCACCAGG + Intergenic
1184205250 22:42998267-42998289 GGAACCTTCTTTGCTGCTGCAGG + Intronic
1185078519 22:48696286-48696308 GGCACCTGCTATGCTACATCTGG - Intronic
949637191 3:5995860-5995882 GCATCCTGCATTGGTGCATCTGG + Intergenic
953256717 3:41297584-41297606 GGACACTGATTTGCTGGATCTGG - Intronic
954991930 3:54848889-54848911 GGGGCCTGCTTTTCTGCACCAGG - Intronic
956431800 3:69193852-69193874 GGATCCTGCTTTGCAAGAACTGG - Exonic
956433834 3:69214019-69214041 TGATCCAGCTTTCCTGGATCAGG - Intronic
959575516 3:107928593-107928615 GCATGCTGCTGTGCTGTATCAGG - Intergenic
962007154 3:131360919-131360941 GGATCCTGCATCTCAGCATCAGG + Intergenic
962009519 3:131380635-131380657 GGATCCTGCATCTCAGCATCAGG + Intergenic
962409272 3:135127336-135127358 GGATCATGCTCCTCTGCATCAGG - Intronic
962443245 3:135442606-135442628 TGACCCTGCCATGCTGCATCAGG + Intergenic
964157951 3:153608832-153608854 GCATCCAGCTTTTCTGCATTTGG - Intergenic
964873805 3:161342775-161342797 GAATCCTGCTCTACTGCAGCTGG + Intergenic
971310722 4:25523649-25523671 GGATTCTGCTTTGCTCCAGCAGG + Intergenic
972289362 4:37677231-37677253 GGATCCAGCCTTGCTGCCTATGG - Intronic
972713906 4:41626449-41626471 GGATCCTGCTTTTCTGTTGCTGG + Intronic
979322481 4:119340694-119340716 GCATTCTGCTTTGCTGCTTCAGG + Intergenic
979765411 4:124459759-124459781 AGATCCTGCTGTGGTGCATTAGG - Intergenic
981317601 4:143355882-143355904 GGATCCTGCTTTCCTACATAAGG + Intronic
981484111 4:145267150-145267172 GGAACCTGGTTTTCTGCATGTGG + Intergenic
981849811 4:149217112-149217134 AGGTCCTGCTTGGCTTCATCTGG + Intergenic
981953394 4:150439649-150439671 AGATTCTGCTTTGCTGCAGTTGG + Intronic
983240459 4:165226307-165226329 GCATTCTGCTTTGCTGCTTCAGG + Intronic
986448677 5:7845693-7845715 GGAATCTGCTTTGCTGCCGCAGG + Intronic
988636887 5:32994603-32994625 AGATGCTGCTTTGCTGCTTGTGG - Intergenic
988664864 5:33315327-33315349 GGAAATTGCTTTGTTGCATCAGG - Intergenic
995023460 5:107392574-107392596 GGATCCAGCTAAGCTGCACCTGG + Intronic
997469726 5:134110404-134110426 GGATGCTGCTACTCTGCATCAGG - Intergenic
1000965048 5:167646573-167646595 CGATCCTGCTTTGCTTCAGTTGG + Intronic
1001116039 5:168940909-168940931 GGATCCTGAGTGGTTGCATCTGG - Intronic
1001756988 5:174178163-174178185 AGATCCTGCTGTGGTCCATCTGG - Intronic
1002795444 6:467734-467756 CCATCCTGCTTAGCTGCAGCTGG - Intergenic
1008139970 6:47821104-47821126 GGAGCTGGCCTTGCTGCATCAGG + Intronic
1012644981 6:101667243-101667265 GGCTTCTGCTTTGCTAGATCAGG + Intronic
1012781502 6:103564258-103564280 GGATCTTGCTTTGTTGCACAGGG - Intergenic
1015792492 6:136977832-136977854 GAAGCCTGTTTTACTGCATCTGG + Intergenic
1017430315 6:154364428-154364450 GGATCCTTCTACGCAGCATCAGG - Intronic
1018901538 6:168054182-168054204 GGAACCTGCATTGCTGCTGCGGG - Intergenic
1018914840 6:168126873-168126895 GGAGCCAGCCTTGCTGCAGCCGG - Intergenic
1019716479 7:2541679-2541701 GGATGCTGCTGGGCTGCATGAGG + Intronic
1022154031 7:27641063-27641085 GGAGTCTGCTTTTCTCCATCAGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024129239 7:46333343-46333365 GGCTGCTGTTTTGCTCCATCAGG - Intergenic
1028776298 7:94681067-94681089 GGGTCCTGCTATGCTGAGTCAGG + Intergenic
1034706963 7:153154465-153154487 TGATCCTGCTAAGCTGCATATGG + Intergenic
1035090527 7:156306424-156306446 GGATCCTGTGTTGCTTCATGTGG - Intergenic
1035090542 7:156306501-156306523 GGATCCTGTGTTGCTTCATGCGG - Intergenic
1035090555 7:156306578-156306600 GGATCCTGTGTTGCTTCATGTGG - Intergenic
1040309113 8:46227491-46227513 GCATCCTGCTTTGAAGCCTCGGG - Intergenic
1041027733 8:53703997-53704019 GGATCCAGCTCTGCTGCCTTGGG + Intergenic
1041727256 8:61029856-61029878 AGTTCCTGCTTGGCTCCATCAGG + Intergenic
1043376123 8:79651813-79651835 GCATCCTGCTTTGCTGAGCCTGG - Intronic
1045494159 8:102694298-102694320 GGGTCCTTCTTTACAGCATCTGG - Intergenic
1047383024 8:124381704-124381726 GGATCCTGTTTTCCTCTATCTGG + Intergenic
1049249320 8:141579776-141579798 TGCTCCTGCTCTGCTGCCTCCGG + Intergenic
1049690959 8:143958689-143958711 GGCACCTGCTCTGCTGCAGCAGG + Intronic
1050162022 9:2729042-2729064 GGGACCTGCTTTCCTGAATCTGG + Intronic
1052557585 9:30037091-30037113 GGATCATGCTCTGCAGCATAAGG - Intergenic
1055604159 9:77950366-77950388 GTAACCTGTTTTCCTGCATCAGG - Intronic
1057039921 9:91840542-91840564 GGATCCAGCCTCGCTGCATGTGG - Intronic
1059087187 9:111317015-111317037 GGATGCCGCTCTGCTGCATCTGG + Intergenic
1191259696 X:58302827-58302849 TGAACCTGCTTTGCTGAATGTGG + Intergenic
1193234323 X:79088473-79088495 GGATCCTGCTCCTCTGAATCTGG - Intergenic
1195875981 X:109540893-109540915 GGGTCCTGCTCTGTTGCCTCAGG - Intronic