ID: 1098247720

View in Genome Browser
Species Human (GRCh38)
Location 12:68537571-68537593
Sequence GAGGCCACAGACCATGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098247713_1098247720 1 Left 1098247713 12:68537547-68537569 CCTGCTGTGCGGCCCAGTTCCTA 0: 87
1: 568
2: 968
3: 1232
4: 1238
Right 1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG No data
1098247712_1098247720 4 Left 1098247712 12:68537544-68537566 CCTCCTGCTGTGCGGCCCAGTTC 0: 89
1: 504
2: 941
3: 1213
4: 1292
Right 1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG No data
1098247709_1098247720 20 Left 1098247709 12:68537528-68537550 CCTCACTCTCCGCTCACCTCCTG No data
Right 1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG No data
1098247711_1098247720 11 Left 1098247711 12:68537537-68537559 CCGCTCACCTCCTGCTGTGCGGC 0: 119
1: 705
2: 841
3: 657
4: 644
Right 1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG No data
1098247708_1098247720 21 Left 1098247708 12:68537527-68537549 CCCTCACTCTCCGCTCACCTCCT No data
Right 1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098247720 Original CRISPR GAGGCCACAGACCATGCCCT GGG Intergenic
No off target data available for this crispr