ID: 1098255443

View in Genome Browser
Species Human (GRCh38)
Location 12:68611105-68611127
Sequence CGCCGGCTGAGGGGAGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098255432_1098255443 4 Left 1098255432 12:68611078-68611100 CCGCGGCGGCGGCCGCGCGGGGC 0: 1
1: 2
2: 6
3: 87
4: 536
Right 1098255443 12:68611105-68611127 CGCCGGCTGAGGGGAGCGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 361
1098255436_1098255443 -8 Left 1098255436 12:68611090-68611112 CCGCGCGGGGCCGGGCGCCGGCT 0: 1
1: 0
2: 3
3: 29
4: 282
Right 1098255443 12:68611105-68611127 CGCCGGCTGAGGGGAGCGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 361
1098255427_1098255443 17 Left 1098255427 12:68611065-68611087 CCGCTGAGGGAAGCCGCGGCGGC 0: 1
1: 0
2: 0
3: 21
4: 142
Right 1098255443 12:68611105-68611127 CGCCGGCTGAGGGGAGCGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098255443 Original CRISPR CGCCGGCTGAGGGGAGCGGG TGG Intronic