ID: 1098260836

View in Genome Browser
Species Human (GRCh38)
Location 12:68668923-68668945
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 2, 2: 4, 3: 33, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098260836 Original CRISPR CCTATTTCATAGCATTGCTG AGG (reversed) Exonic