ID: 1098260836

View in Genome Browser
Species Human (GRCh38)
Location 12:68668923-68668945
Sequence CCTATTTCATAGCATTGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 2, 2: 4, 3: 33, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098260836 Original CRISPR CCTATTTCATAGCATTGCTG AGG (reversed) Exonic
902047652 1:13537967-13537989 CCTATCTCATATCGTAGCTGAGG - Intergenic
902558273 1:17260007-17260029 CCTGTCTCCTATCATTGCTGTGG + Intronic
903926261 1:26832906-26832928 CCTACCTCATAGGATTACTGGGG - Intronic
903972898 1:27130667-27130689 TCTACCTCATGGCATTGCTGAGG - Intronic
904495264 1:30882920-30882942 CGCAGCTCATAGCATTGCTGTGG + Intronic
905706174 1:40060588-40060610 CCTACTTCATATTCTTGCTGTGG - Intronic
906219675 1:44068899-44068921 CCTTTTACATAGAATTTCTGGGG + Intergenic
907141784 1:52192954-52192976 CCTATCTCATAGGATTGCTGTGG - Intronic
907205120 1:52763248-52763270 CCTTTTGCATAGGATTGCTTGGG + Intronic
907814995 1:57910111-57910133 CCAATTTCATTTCCTTGCTGGGG - Intronic
908149702 1:61287235-61287257 CCTCATTCATAGCATTGTTAAGG + Intronic
910893049 1:92038072-92038094 CCTATTTCTTAGAATTGTTTAGG + Intronic
911574680 1:99561453-99561475 CCCATTTCATAGTGTTGCTGAGG - Intergenic
912336916 1:108871666-108871688 CCTACTTCATAGGGTTGCCGTGG + Intronic
913212639 1:116594544-116594566 TTTATTTCATAGGATTGGTGAGG - Intronic
914202996 1:145503118-145503140 GGAATTTCATAGCATTGGTGTGG - Intergenic
914236926 1:145821052-145821074 GGAATTTCATAGCATTGGTGTGG - Intronic
914390486 1:147217281-147217303 ACTATCTTATAGCATTGTTGTGG + Intronic
914482118 1:148076269-148076291 GGAATTTCATAGCATTGGTGTGG - Intergenic
915196839 1:154195795-154195817 CCTAATTCATTGGGTTGCTGTGG - Intergenic
919503351 1:198366610-198366632 GCAATTTCATGACATTGCTGAGG - Intergenic
921564613 1:216701650-216701672 CCTATTTATTAGCCTTGCTTTGG + Intronic
922254007 1:223875711-223875733 CCTACTTCACAGGATTGCTATGG + Intergenic
924112893 1:240717238-240717260 GCTATTTCATAGAGTTGATGGGG - Intergenic
1063762228 10:9092964-9092986 CCAATGTCATAGCATTGGTGTGG + Intergenic
1064925657 10:20565967-20565989 CTTTTTTCACAGCATTGTTGAGG - Intergenic
1065773274 10:29097155-29097177 TCTATTTCATAGAATTATTGAGG + Intergenic
1067211134 10:44261121-44261143 CCTGTTCCATAGCAGTGATGAGG + Intergenic
1067779208 10:49186847-49186869 CCTATTGCACAGAGTTGCTGTGG + Intronic
1068581039 10:58740100-58740122 CCTACTTCATAGGATGGCTGTGG + Intronic
1070517886 10:77225140-77225162 CCTCTTTCAGAACATTGCAGGGG - Intronic
1070729692 10:78817911-78817933 CCCATTCCATATCATTGCTTTGG - Intergenic
1071898863 10:90096197-90096219 CCTATTTAATAGTTTTGCTGAGG + Intergenic
1072215241 10:93282212-93282234 CCAACATCATAGCATTGTTGTGG - Intergenic
1072626962 10:97118802-97118824 CCTCTCTTATAGGATTGCTGTGG + Intronic
1072717984 10:97764313-97764335 TCTATTTCACAGGGTTGCTGAGG - Intergenic
1074454221 10:113583366-113583388 CCTCTTTCATGGCTTTCCTGAGG + Intronic
1074665146 10:115714020-115714042 ACTATTTCTAAGCTTTGCTGAGG - Intronic
1075395272 10:122122389-122122411 CCTTCTTCATAGCAGTGATGAGG + Intronic
1076005725 10:126947128-126947150 CCTATTTCATAGGGTTGATATGG + Intronic
1076250674 10:128981589-128981611 CATATTTTATAGAAGTGCTGTGG - Intergenic
1077381675 11:2244872-2244894 ACTTTTTCTTAGCATTGCGGTGG - Intergenic
1078280694 11:9898133-9898155 CCTATTTCAAACTACTGCTGCGG + Intronic
1079360693 11:19768040-19768062 CCTGTTTCCCAGGATTGCTGAGG - Intronic
1080734107 11:34993555-34993577 CCTTTTTCATAGCATTGAAAAGG + Intronic
1081177534 11:39947063-39947085 ACTATTCCATAGGGTTGCTGAGG - Intergenic
1081742031 11:45447710-45447732 CCTATTTCATATCCTTGATCTGG - Intergenic
1082078282 11:47991827-47991849 CCTACTTTATAGGATTGCTGTGG + Intronic
1083561892 11:63679726-63679748 CCTTTTTCAGAGCATTGCAAAGG + Intergenic
1085746658 11:79120883-79120905 TCTATCTCATAGATTTGCTGTGG - Intronic
1086207989 11:84283365-84283387 CTTATCTCATAGGATTGTTGAGG + Intronic
1086560922 11:88168197-88168219 CCTATTTGTTAGAATTACTGTGG + Intronic
1086800091 11:91162566-91162588 CCTATTGCATAGGGTTGTTGTGG - Intergenic
1088349963 11:108874986-108875008 CCTATTTCATAGCACTGTTTGGG + Intronic
1088474827 11:110224464-110224486 CCTTTTTCAGAGCATTTCTCTGG - Intronic
1088610976 11:111576508-111576530 CCTATTTGAGGCCATTGCTGAGG + Intergenic
1088778868 11:113114256-113114278 ACTGTTTCAGAGCATTGCAGAGG + Intronic
1088816144 11:113422355-113422377 CATACATCATAGCATTGTTGAGG - Intronic
1089709916 11:120307297-120307319 CCTATTTCTTTTCATTGCTCAGG - Intronic
1090660987 11:128881273-128881295 CCTGATTCATAGCCCTGCTGAGG - Intergenic
1091794379 12:3289222-3289244 CCTATTTTATAGATTTGTTGTGG + Intergenic
1092911319 12:13147182-13147204 CCAATTTCATAGGACTGTTGTGG + Intergenic
1092994485 12:13935634-13935656 CCTATTTGATGGCATTATTGTGG + Intronic
1093993886 12:25620883-25620905 CCTATTGCATAGTGTTGGTGGGG - Intronic
1095255543 12:40031556-40031578 TCTATTTCATAAGACTGCTGGGG + Intronic
1095438752 12:42221262-42221284 CCCATTTTATAACCTTGCTGTGG - Intronic
1097864880 12:64551609-64551631 TCTACTACTTAGCATTGCTGTGG + Intergenic
1097916708 12:65028316-65028338 CCTTTTGCTTAGCATTGCTTTGG + Intergenic
1098260836 12:68668923-68668945 CCTATTTCATAGCATTGCTGAGG - Exonic
1098769563 12:74536496-74536518 TCTATTTCACAGCAGTTCTGGGG + Intergenic
1100061204 12:90577980-90578002 CCTTTTGCATAGGATTGCTTTGG - Intergenic
1100779229 12:98006803-98006825 CCTATTTCATAGACTTGTTGGGG - Intergenic
1100883378 12:99042565-99042587 CTTGTTCCATAGCATTGTTGAGG + Intronic
1101122689 12:101599453-101599475 CCTATTTCTAAGCATTTCTCAGG + Intronic
1101595230 12:106158801-106158823 TCTGTTCCATTGCATTGCTGAGG + Intergenic
1101664926 12:106804172-106804194 CCTACTTCATAGGGTTGTTGAGG - Intronic
1102588258 12:113938443-113938465 CCTATCTCTAAGAATTGCTGGGG + Intronic
1104884756 12:132100300-132100322 CCTCTTTCTGAGCGTTGCTGTGG + Intronic
1105215886 13:18285167-18285189 TTTATTTCATAGGATTGGTGAGG - Intergenic
1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1105865117 13:24452131-24452153 CCTACCTCCTAGGATTGCTGAGG - Intronic
1106076336 13:26464346-26464368 ACTAGTTCATACCATTACTGAGG + Intergenic
1107800771 13:44106231-44106253 CCTATTTGCTTGCCTTGCTGTGG + Intergenic
1108269520 13:48745921-48745943 CCTACTTCATAGTATTGCCAAGG + Intergenic
1108316221 13:49240290-49240312 TCTATTTCATAGGGTTGTTGTGG + Intergenic
1108412820 13:50167334-50167356 CCTGTTTCATACCAATGTTGTGG + Intronic
1108558862 13:51623443-51623465 CCTAATTCATAGCAGTTGTGAGG + Intronic
1108692916 13:52875839-52875861 CCTGTTTCATAAAACTGCTGGGG + Intergenic
1108742502 13:53352931-53352953 CCTAATGAATAGAATTGCTGTGG + Intergenic
1109409865 13:61948642-61948664 CCTATTGCTTAGGATTGCTTTGG - Intergenic
1109662287 13:65478383-65478405 CTTATTTCATAGTTTTGTTGTGG - Intergenic
1109889930 13:68597856-68597878 CCTATCACATTGCATTGCTTAGG - Intergenic
1110000153 13:70187200-70187222 GCTATTTCATAGGGTTACTGTGG - Intergenic
1112690648 13:101890215-101890237 CATATTTCAGAGCCTTGCTGAGG + Intronic
1113251864 13:108462094-108462116 CCCATTCCATATCATTGCTCTGG - Intergenic
1114569396 14:23655832-23655854 GAAAGTTCATAGCATTGCTGTGG - Intergenic
1116087385 14:40257803-40257825 CCTATTACATAGAGTTGTTGAGG - Intergenic
1118454344 14:65931125-65931147 TCTATTTCATGGCATTGTTAAGG - Intergenic
1118472012 14:66082773-66082795 CCCAATTCACAGTATTGCTGTGG + Intergenic
1119619578 14:76122017-76122039 CCTGTTTCATAAGATTGATGAGG + Intergenic
1122844554 14:104485468-104485490 GCTATTGCATAGCCATGCTGTGG + Intronic
1124954227 15:34349333-34349355 CCTAATTCACAGAGTTGCTGAGG + Intronic
1125070937 15:35552177-35552199 CCTACTTCATAAATTTGCTGTGG - Intergenic
1126375687 15:47994640-47994662 CCTATTGCATAGCATTACAGTGG - Intergenic
1126561906 15:50053177-50053199 CCTATTTCATAAGAATGTTGTGG - Intronic
1127153226 15:56100216-56100238 CCTATCTCACAGGACTGCTGGGG + Intronic
1127418633 15:58782824-58782846 CCTGCTTCATAGGATTGCTGAGG + Intronic
1127845116 15:62863648-62863670 CTTATTTCTTAGAATTGCTTTGG - Intergenic
1128411897 15:67407855-67407877 ACTAATTCATAGCATTATTGTGG + Intronic
1129811545 15:78515051-78515073 CCAATTTCATACAATAGCTGGGG - Exonic
1130056652 15:80532111-80532133 CCTATTCTATAGTGTTGCTGTGG - Intronic
1130554303 15:84912082-84912104 CCTCTTTCCTGGCATTGCTATGG - Intronic
1134420100 16:14078888-14078910 CCCAATTCTTAGCACTGCTGAGG - Intronic
1136411106 16:30077733-30077755 CCAACCTCATAGGATTGCTGGGG - Intronic
1137529419 16:49268447-49268469 GGTATTTCTTTGCATTGCTGTGG - Intergenic
1137698894 16:50481603-50481625 CCTATGTTCTAGAATTGCTGAGG - Intergenic
1137752645 16:50878340-50878362 TCTATCTCATGGCATTGTTGTGG - Intergenic
1138285985 16:55810652-55810674 TCTATTTCAGTGCATTGCTAAGG - Exonic
1139276215 16:65729855-65729877 CCTGTTTCATAGCATTGCTGGGG + Intergenic
1140998015 16:80279816-80279838 CCTGCTTGTTAGCATTGCTGAGG - Intergenic
1146421267 17:32688093-32688115 CCTCTTCCATAGCATAGCTTGGG + Intronic
1147458081 17:40551123-40551145 CCTATGTCCTAGGATTGTTGTGG - Intergenic
1148282360 17:46358655-46358677 CCACTGTCATAGCAGTGCTGAGG - Intronic
1148304578 17:46576580-46576602 CCACTGTCATAGCAGTGCTGAGG - Intronic
1149037574 17:52152816-52152838 CCTATTTCAAAGCATTGCTGAGG - Intronic
1149746521 17:59104382-59104404 CTGTTTTCAGAGCATTGCTGAGG - Exonic
1155375982 18:25158110-25158132 CCTATCTCATAGAATAGTTGTGG + Intronic
1155415805 18:25598038-25598060 CCTACCTACTAGCATTGCTGAGG - Intergenic
1156478037 18:37418683-37418705 CCTGTCTCGTAGAATTGCTGAGG + Intronic
1158656724 18:59343339-59343361 CCTTTTGCTTAGCATTGCTTTGG - Intronic
1158822869 18:61180953-61180975 CCTTTTGCATAGGATTGCTTTGG - Intergenic
1159583076 18:70254855-70254877 ACTTTTTCACAGCAATGCTGTGG + Intergenic
1160450041 18:78956934-78956956 TATATTACATAGCATTGCTCTGG + Intergenic
1163110766 19:15159968-15159990 CATGTTCCATAGCCTTGCTGGGG - Exonic
926907052 2:17815927-17815949 CTTATTTCCTAGGGTTGCTGGGG - Intergenic
927786589 2:25979222-25979244 CCTATTAAGTTGCATTGCTGAGG - Intronic
928153797 2:28857594-28857616 CCTATTTCATAGAGTTGTTGAGG - Intronic
928183843 2:29091510-29091532 CCCTGTTCATGGCATTGCTGGGG + Intergenic
928578437 2:32680437-32680459 GCTATTTCACAGAAGTGCTGAGG + Intronic
930418128 2:51115860-51115882 CCTACTTCATAGGATTACTGGGG + Intergenic
931104188 2:59036317-59036339 CCTACTTCATAGGTTTGCTGTGG - Intergenic
933416674 2:81995368-81995390 CCTATTTTATAATTTTGCTGGGG + Intergenic
933775932 2:85771181-85771203 CCTACTTCACAGTTTTGCTGAGG - Intronic
933967622 2:87442847-87442869 CCAATTTCCTAGCAATGCTTTGG + Intergenic
934279124 2:91595904-91595926 CCTATCTCATAGGGGTGCTGAGG - Intergenic
934298443 2:91761559-91761581 TTTATTTCATAGGATTGGTGAGG + Intergenic
936326175 2:111507649-111507671 CCAATTTCCTAGCAATGCTTTGG - Intergenic
936840896 2:116767203-116767225 CCTATTTCATTAAATTCCTGGGG - Intergenic
937719456 2:125076877-125076899 GCTACTTCATAGAATTTCTGTGG + Intergenic
939832774 2:147092626-147092648 CTTATTACATAACATTGTTGTGG - Intergenic
941706038 2:168658823-168658845 CCTGTTTAATAGCATGGCTCTGG - Intronic
942066100 2:172273146-172273168 CCTTTTTCTTAGGATTGCTTAGG + Intergenic
943322103 2:186457206-186457228 CTTATTTCATAGCATTATTGTGG + Intergenic
943856834 2:192806442-192806464 CCTATTTCATGGCAATTTTGTGG - Intergenic
944421828 2:199538800-199538822 TCTACTTCATAGAAATGCTGTGG - Intergenic
945147584 2:206754546-206754568 CCTATCTCCTAGAATTGATGTGG - Intronic
945858714 2:215096240-215096262 CCTACTTCATAGCATTGTTGGGG - Intronic
946617230 2:221523230-221523252 CCTACTTCTTAGCGTTGTTGGGG - Intronic
946810701 2:223521986-223522008 CCTTGTTCATAGCATTTATGTGG - Intergenic
948096911 2:235342819-235342841 CTTATTACACAGCATTACTGTGG + Intergenic
1169682741 20:8234007-8234029 CATAGTTCATAGCATTGCTATGG + Intronic
1170014057 20:11760866-11760888 CATTTATAATAGCATTGCTGTGG - Intergenic
1170059298 20:12242757-12242779 TCTATTGGATAGCATTGCTCTGG - Intergenic
1170218208 20:13914641-13914663 CCCACTTCATAGGGTTGCTGTGG + Intronic
1172622748 20:36330518-36330540 CCTACTTCATAGGGTAGCTGAGG + Intronic
1173359686 20:42331285-42331307 CCTCTGTAAAAGCATTGCTGTGG - Intronic
1175275593 20:57768133-57768155 CCTATTTAAATGCATTCCTGAGG + Intergenic
1176951487 21:15052184-15052206 CCCATTTCATAGCTTTTCCGTGG + Intronic
1178237979 21:30865496-30865518 CCTAATTCATAAGTTTGCTGTGG - Intergenic
1178350764 21:31872105-31872127 CCAATCTCAAAGCATTGCTATGG + Intergenic
1179149988 21:38801775-38801797 CCTATTTCCTGGCAAAGCTGGGG - Intergenic
1179185079 21:39079408-39079430 CCAGTTTCATAGGATGGCTGTGG + Intergenic
1179226092 21:39454776-39454798 GCTATTTTATAACAATGCTGAGG - Intronic
1179387099 21:40954129-40954151 CCTACCTCATAACACTGCTGTGG + Intergenic
1180020496 21:45122410-45122432 CTCTTTTCATAGCATTGCTGTGG + Intronic
1180044346 21:45296922-45296944 ACTATTTAACAGCATTGCTGTGG - Intergenic
1180658881 22:17448511-17448533 TTTATCTCATAGTATTGCTGAGG + Intronic
1182687655 22:32133326-32133348 CCTACTTCACAGGGTTGCTGGGG - Intergenic
950154584 3:10712158-10712180 CCTGCTCTATAGCATTGCTGGGG - Intergenic
950233691 3:11299088-11299110 CCCATTACTTAGCATTGCTGTGG + Intronic
951890283 3:27561965-27561987 CCTATTTCTTGGCCTGGCTGTGG - Intergenic
951982325 3:28579058-28579080 CCTATTTCATAGACTTTCCGAGG - Intergenic
954442985 3:50531773-50531795 CCTACTTCATAGGGTTGCTCTGG + Intergenic
955156443 3:56421397-56421419 CCTTTTCCATAGCTCTGCTGAGG + Intronic
955754556 3:62214741-62214763 CCTACTTCATAGGACTGTTGGGG - Intronic
956653329 3:71525649-71525671 CTTATTTCATAATCTTGCTGAGG + Intronic
956928611 3:74017114-74017136 CATATTTCATAGCATAACTTTGG - Intergenic
957331610 3:78771348-78771370 CCTTTTGCTTAGCATTGCTTTGG + Intronic
959721079 3:109490150-109490172 TCTACTTCATAGCATTGTTGTGG + Intergenic
960326978 3:116309222-116309244 CCCATTTCATAGACATGCTGAGG + Intronic
960726305 3:120673850-120673872 CCTATTTCATAGCTGTGGTGAGG - Intronic
961021262 3:123509093-123509115 CCTAGTCTATAGCATTGCTATGG - Intronic
962204096 3:133421022-133421044 CCTGTTTCATAGGATTGCTGTGG + Intronic
963024564 3:140906155-140906177 CCTCCTTCATATCATTGCTTTGG + Intergenic
963227396 3:142876341-142876363 CCTACCTCATAGGATTGCTTTGG - Intronic
964040429 3:152254832-152254854 CTTATTTCATAGGACTGATGAGG - Intronic
965624077 3:170669695-170669717 CCTACTTCATAGACTTGCTGAGG - Intronic
966310715 3:178590621-178590643 CCTACTTTGTAGCATTGATGAGG - Intronic
966544376 3:181128625-181128647 CCTGCTTCATTGTATTGCTGGGG - Intergenic
967530722 3:190546595-190546617 TCTACTTCCTAGGATTGCTGAGG - Intronic
968116445 3:196094020-196094042 CCTGTTTCACAGAATTGTTGGGG - Intergenic
969031665 4:4220570-4220592 CCTATCTCATAGGGGTGCTGAGG + Intronic
969457299 4:7307393-7307415 CCCTTTTCCTACCATTGCTGTGG + Intronic
969555530 4:7906304-7906326 CCTTTTTCACAGAACTGCTGAGG + Intronic
970823321 4:20245011-20245033 CATTTTTCACGGCATTGCTGGGG + Intergenic
971395749 4:26225826-26225848 CCTATTTAGTAGCATGGCAGTGG - Intronic
972742350 4:41899547-41899569 CCTACTTCATAGGGTTGCTAAGG - Intergenic
974576685 4:63733857-63733879 GCTATTTCAAAGGATTGGTGAGG + Intergenic
974715248 4:65661072-65661094 CCTACTTCATATAATTGCTATGG - Intronic
974945501 4:68523111-68523133 CCTACTTAATAGCATTGCTGAGG - Intergenic
975109449 4:70607558-70607580 TCTATTTCACAGTATTGTTGTGG - Intergenic
975332569 4:73134128-73134150 CCTTTTTCATAGTGTTACTGAGG + Intronic
975907290 4:79228645-79228667 TCTATTCCTTTGCATTGCTGAGG + Intronic
976243031 4:82978538-82978560 CCTACCTCATAGGATTGCTGGGG + Intronic
978280203 4:107002890-107002912 CCCATCTCTTAGCATTGTTGTGG + Intronic
978372026 4:108038738-108038760 CCTATGCCATAGGGTTGCTGGGG + Intergenic
978379573 4:108112606-108112628 CCTATTTCATAGGGTTGTTAAGG + Intronic
981355298 4:143783335-143783357 ACTATTTCTAAGGATTGCTGGGG + Intergenic
982186381 4:152805746-152805768 CCTACCTCATAGCATTGTTGTGG - Intronic
983045583 4:162982857-162982879 CCTTTTGCATACCATTCCTGTGG - Intergenic
983404618 4:167312333-167312355 CCTTTTTCTTAGTATTGCTTTGG - Intergenic
983821531 4:172199254-172199276 CCTATTTAATAGGATTTTTGTGG + Intronic
984404539 4:179310535-179310557 CCTTTTGCTTAGCATTGCTTTGG + Intergenic
990086242 5:51981757-51981779 CCTTTTTCATGGGGTTGCTGTGG - Intergenic
990865579 5:60376251-60376273 CTTATCTCATAGGGTTGCTGTGG - Intronic
991251954 5:64572756-64572778 CCTAATTCAAAACATTGCTTTGG - Intronic
993027017 5:82658967-82658989 CCTATTTCAGTGGGTTGCTGTGG + Intergenic
994675325 5:102814059-102814081 TCTATTTCCCAGCATTGCTGGGG - Intronic
995000769 5:107125641-107125663 TATATTTCACAGCATTGTTGGGG + Intergenic
997189421 5:131916670-131916692 CCTTTTTGCTATCATTGCTGAGG + Intronic
998646092 5:144063926-144063948 CCTACTTCATAAGATTGTTGTGG - Intergenic
1000786212 5:165547276-165547298 CCTACTTCAAAGCATTATTGGGG - Intergenic
1001135957 5:169103108-169103130 CCTATCTCATAGGATTCCTGTGG - Intronic
1004763425 6:18696869-18696891 TCTAGCTCATAGAATTGCTGTGG - Intergenic
1005296853 6:24435309-24435331 CCAATTTCATAGCTTTTATGGGG + Intronic
1005563091 6:27061466-27061488 GCTATTTCATAACATGGTTGGGG + Intergenic
1007877922 6:45127429-45127451 CCTACCTCATAGTATTGTTGTGG - Intronic
1008012832 6:46487400-46487422 CCTACTTCATAGCTTTGATAGGG - Intronic
1009330548 6:62414370-62414392 CCTATTTCTTATAATTGCTTTGG - Intergenic
1009707035 6:67265825-67265847 CCTCTTTCATAGGGCTGCTGTGG + Intergenic
1010772031 6:79842952-79842974 CCTATTTCATAGGTTTGTTGAGG + Intergenic
1011239538 6:85256294-85256316 CCTATCTCAGAGGGTTGCTGTGG - Intergenic
1011421526 6:87178626-87178648 CCTATTTCAGAGAGGTGCTGAGG - Intronic
1011477458 6:87761978-87762000 CCTACTTCATAGGATTATTGTGG + Intergenic
1011497554 6:87951476-87951498 CCTATTTCTGAGCCTTTCTGGGG + Intergenic
1012008055 6:93741810-93741832 CCTTTTACATAGGATTGCTTTGG - Intergenic
1012240469 6:96865417-96865439 TCTATTTCATAACATTGCACAGG - Intergenic
1014468157 6:121781910-121781932 CCTATCTCATAGCATTATGGTGG - Intergenic
1015048050 6:128802703-128802725 CTTATTTTATCGCATTACTGAGG + Intergenic
1015072882 6:129118189-129118211 CCTATTTTATAGCATTGTGCTGG + Intronic
1015103599 6:129509806-129509828 CCTTTTGCATAGGATAGCTGTGG + Intronic
1015183790 6:130390493-130390515 CCTACTTGATAGGACTGCTGAGG + Intronic
1015572882 6:134639869-134639891 TATATTTCATAGCAATCCTGTGG - Intergenic
1016552319 6:145295564-145295586 TCTATTTCATTGTATTGCAGTGG + Intergenic
1017396791 6:154010150-154010172 CCTACTACACAGCATTGTTGTGG + Intergenic
1017667328 6:156733142-156733164 CCTATTTCATAGAGTTGGGGTGG + Intergenic
1019861419 7:3661868-3661890 CCTGCCTCATAGCATGGCTGAGG + Intronic
1020435882 7:8161880-8161902 CTTATTTCACAGCATTATTGTGG + Intronic
1020619204 7:10497382-10497404 CCTCTTTCACAGGGTTGCTGTGG - Intergenic
1020736133 7:11950826-11950848 CCCATTCCCTGGCATTGCTGGGG + Intergenic
1021465581 7:20939176-20939198 CTTATTTTATAGGATTGTTGTGG + Intergenic
1021850042 7:24798801-24798823 GATATTCCATAGCATTGCTATGG + Exonic
1022476303 7:30712712-30712734 CCTGTCTCCCAGCATTGCTGTGG + Intronic
1022573780 7:31478322-31478344 ATTAATTCACAGCATTGCTGAGG + Intergenic
1023026681 7:36057075-36057097 GCCTTTTCATAGCATTGTTGAGG + Intergenic
1026119422 7:67523901-67523923 CCTGTTTCATTGCACAGCTGTGG + Intergenic
1028213970 7:88109176-88109198 CCTAATTCATAGCAAATCTGTGG + Intronic
1029790500 7:102838278-102838300 CCTACTTCATAGAGTTGTTGGGG + Intronic
1029934644 7:104410469-104410491 CCTATTCCACAGGATTGCTGAGG + Intronic
1030060763 7:105619026-105619048 CCAACTTCACAGCATTGCTCAGG + Intronic
1030696332 7:112588788-112588810 ACTCTTTCATAGGACTGCTGTGG - Intergenic
1030854095 7:114529249-114529271 CTTATTTCATAGAATTTCTGAGG + Intronic
1031926882 7:127647463-127647485 CCTACCTCATAGGATTGCTTTGG - Intergenic
1032177630 7:129645198-129645220 TCTACTTCATAGAATTACTGGGG - Intronic
1032840725 7:135711500-135711522 GCTGCTTCATAGCACTGCTGTGG - Intronic
1033927770 7:146485374-146485396 CAAATTTCTTAGAATTGCTGTGG - Intronic
1035917188 8:3637655-3637677 CCTGTTTCATATGATTGTTGGGG - Intronic
1038869633 8:31480084-31480106 CCTTCTTCATTGCAATGCTGTGG + Intergenic
1038933629 8:32223319-32223341 TCTATTTCATTGCATTGCAAAGG + Intronic
1040530279 8:48261003-48261025 CCCATCTCACAGTATTGCTGTGG + Intergenic
1040732366 8:50464074-50464096 CACATTTCATAGCATTGAAGAGG + Intronic
1040841932 8:51793213-51793235 CCTCTTTCATAGGGCTGCTGTGG - Intronic
1042978912 8:74503596-74503618 ACTACTTCATAGCATTGTTCTGG + Intergenic
1043240789 8:77932395-77932417 CATATTTTATAGCATTTATGTGG + Intergenic
1046860368 8:119085043-119085065 CCAACCTCATAGGATTGCTGTGG - Intronic
1047753908 8:127903877-127903899 CTTATTTCTTAGAATTGCTTTGG + Intergenic
1048315643 8:133359775-133359797 CCTCTCTCACAGCACTGCTGGGG + Intergenic
1052136919 9:24923857-24923879 CATATTTCATAAAACTGCTGGGG - Intergenic
1052550578 9:29942322-29942344 CCTTTTTCACAGAATTGTTGTGG - Intergenic
1053653638 9:40194029-40194051 CCTATTTTATAGGGCTGCTGTGG - Intergenic
1053904037 9:42823320-42823342 CCTATTTTATAGGGCTGCTGTGG - Intergenic
1054530948 9:66182194-66182216 CCTATTTTATAGGGCTGCTGTGG + Intergenic
1058530260 9:105899668-105899690 CCTCTTTCATAGGGCTGCTGTGG + Intergenic
1059102906 9:111486610-111486632 CCTATTTCATAAGATTGTTGTGG - Intergenic
1060168927 9:121444469-121444491 ATTATTTCAGCGCATTGCTGTGG + Intergenic
1060996911 9:127879314-127879336 CCTATTTCTTACCAATGCTATGG - Intergenic
1061130752 9:128706482-128706504 CCTCTTTCATATCACGGCTGGGG - Intronic
1185815309 X:3149654-3149676 ACCAGTTCATGGCATTGCTGAGG + Intergenic
1187310102 X:18133558-18133580 CCTACTTCACAGAGTTGCTGAGG - Intergenic
1187440316 X:19312171-19312193 CCTACCTCATAGGATTGTTGTGG + Intergenic
1188741384 X:33786601-33786623 CCTTTTTCTTAGGATTGCTTTGG + Intergenic
1192115222 X:68404089-68404111 CCTATTTCAGAGAATTGGTATGG + Intronic
1192343751 X:70284334-70284356 CCTTTTTCCTAGCTTTGCTGGGG + Intronic
1193498664 X:82244391-82244413 CCTTTTGCTTAGCATTGCTTTGG - Intergenic
1194131981 X:90092685-90092707 TTTGTCTCATAGCATTGCTGGGG - Intergenic
1194538159 X:95133704-95133726 CCTGTTTCATTACATTGCTTTGG - Intergenic
1194712724 X:97254649-97254671 CCTACTTCATAGTATTGCTTTGG - Intronic
1196581102 X:117379974-117379996 CCTTTTTCAAAGCAGTGCTGTGG - Intergenic
1198219401 X:134585903-134585925 CCTGAGTCACAGCATTGCTGGGG + Intronic
1198528160 X:137523049-137523071 CCTACTTCATAGAGTTGATGTGG - Intergenic
1198850028 X:140956345-140956367 TATATATCATAGCATTGCTGAGG + Intergenic
1199224037 X:145351535-145351557 CCTCTTTCTTAGCATTGCATTGG - Intergenic