ID: 1098263858

View in Genome Browser
Species Human (GRCh38)
Location 12:68698833-68698855
Sequence CACTCTTTATGCTATAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098263858 Original CRISPR CACTCTTTATGCTATAATGG GGG Intronic
903079661 1:20799496-20799518 CACTATTTATTCTACAATGTAGG + Intergenic
903085402 1:20853184-20853206 CACTCTTCATGTTATATTTGAGG - Intronic
904491928 1:30866278-30866300 CATTGTTTATGATAAAATGGGGG + Intergenic
905133976 1:35784047-35784069 AACTCTTTATGCTTTAAAGTGGG + Intergenic
911390611 1:97236608-97236630 TACTATATATACTATAATGGTGG + Intronic
913046930 1:115081733-115081755 CACACTTTGTGCTATTATGTTGG + Intronic
924367663 1:243312919-243312941 GCCTCTTTATGCCATAAGGGAGG + Intronic
1065583089 10:27191350-27191372 TACTCTGTATGATATAATGGTGG + Intergenic
1065706346 10:28474752-28474774 GAATCTTTATACTTTAATGGGGG - Intergenic
1068804400 10:61178531-61178553 CATTCTTTATGTGAAAATGGAGG - Intergenic
1073216663 10:101840261-101840283 GGCTCTTTATGCCAAAATGGTGG - Intronic
1073927298 10:108532449-108532471 CACTCTTTAAGATGCAATGGAGG + Intergenic
1075358388 10:121805438-121805460 CACTCCTTATGGGATAATTGTGG - Intronic
1080279068 11:30535713-30535735 CACTCATTCTGCTTTAATGAGGG - Intronic
1081053817 11:38382844-38382866 CATTCTTTATGCCCTGATGGAGG - Intergenic
1087303645 11:96463856-96463878 CAGACTTTATGCTAAAATCGTGG - Intronic
1091143436 11:133256018-133256040 CACTATTTTTGCTACAAAGGCGG + Intronic
1092049797 12:5460281-5460303 TATTCTGTATGCTATAATGGTGG - Intronic
1092250364 12:6891687-6891709 CCCTCTTTCTTCTATCATGGTGG + Intronic
1093391270 12:18626447-18626469 CACTCTTAAGACTATAACGGTGG - Intronic
1097931138 12:65188169-65188191 GAGTCTTTATACTATACTGGAGG - Intronic
1098132020 12:67361083-67361105 TACTCTTTCTGCTATGATAGAGG - Intergenic
1098263858 12:68698833-68698855 CACTCTTTATGCTATAATGGGGG + Intronic
1106941776 13:34788015-34788037 CAATCCTTATTCTTTAATGGTGG - Intergenic
1110418516 13:75278542-75278564 TACTCCTTAGGCTATAGTGGGGG + Intergenic
1110440112 13:75518219-75518241 TACTCTGTGTGCTTTAATGGTGG + Intergenic
1111235090 13:85399468-85399490 CACTCTTTTTTTTTTAATGGAGG + Intergenic
1115726625 14:36224268-36224290 GCCTCATTATGCTATAATGAAGG - Intergenic
1115842579 14:37489009-37489031 CACTCTTTAGGATATTATCGAGG - Intronic
1115951157 14:38723390-38723412 GACACTTTATGATAAAATGGAGG - Intergenic
1118499179 14:66341983-66342005 CACTCTTTATGGGATAATGAGGG - Intergenic
1126967264 15:54068818-54068840 CACTTTTGATCCTATAATGAGGG + Intronic
1135885963 16:26308095-26308117 CATACTTTTTCCTATAATGGTGG - Intergenic
1139043580 16:63030181-63030203 CACTTTTTATACTATAAGGCCGG - Intergenic
1140649336 16:77069757-77069779 CACTCTTCATGCTAGACTAGAGG - Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1151877018 17:76872667-76872689 CTCTCTTTATCCTATAGTGGGGG + Exonic
1153992567 18:10413292-10413314 CACCTTTTATGCTATCCTGGGGG - Intergenic
1156457587 18:37303463-37303485 CAGTAATTATGTTATAATGGTGG + Intronic
1158714239 18:59863564-59863586 TACTGTGTATACTATAATGGTGG + Intergenic
1165410467 19:35657513-35657535 CACATTTTATGCTATAAGGCAGG - Intronic
1167021991 19:46884134-46884156 TACTTTTTATGAAATAATGGTGG - Intergenic
1167296721 19:48654786-48654808 CTGTCTTTGCGCTATAATGGAGG - Intergenic
925494365 2:4429593-4429615 CACTATTTATTCTATCTTGGAGG + Intergenic
932388552 2:71362293-71362315 CACTCTTAGGGCTATAATTGCGG + Intronic
933517855 2:83329062-83329084 CACTCTTTATACTATAACCAGGG - Intergenic
943530062 2:189068390-189068412 TAATTTTTATGATATAATGGTGG - Intronic
944160922 2:196658550-196658572 CACTGTTTATGATATAAAAGAGG + Intronic
1171419736 20:25009983-25010005 TAGTATTTATGCTATAATGTGGG - Intronic
1173981940 20:47231224-47231246 TCCTCTTTCTGCTGTAATGGGGG - Intronic
1174301764 20:49587613-49587635 CACTTTTTCTGCTTTAGTGGAGG - Intergenic
1177569822 21:22872663-22872685 CACTCCTTAGATTATAATGGAGG + Intergenic
1184062722 22:42093911-42093933 TACTCTGGATGTTATAATGGTGG + Intergenic
949790691 3:7789017-7789039 GATTATTTATGCTATAAAGGAGG - Intergenic
951463120 3:22972137-22972159 CCCTCTATATGCTAGGATGGTGG + Intergenic
956549404 3:70441533-70441555 GACACTTTAGCCTATAATGGCGG - Intergenic
958055029 3:88399149-88399171 CAGTCTTTATGCTATTGTTGAGG - Intergenic
960593833 3:119390682-119390704 CATTCTTGATCCTATGATGGGGG - Intronic
963544078 3:146632840-146632862 CAATGTTTCTGCTATACTGGAGG - Intergenic
964217422 3:154302097-154302119 CACTCTTTGTGCTATACATGAGG - Intronic
971597381 4:28548470-28548492 TACTGTTTTTGCTATCATGGAGG + Intergenic
971934105 4:33125055-33125077 TACTCTTTATGCTTAAATTGCGG + Intergenic
974065194 4:57071187-57071209 CACTGTTTTTGATATATTGGGGG + Intronic
974338740 4:60586423-60586445 CACTCTTTCTGATGGAATGGGGG + Intergenic
976573635 4:86642232-86642254 CATCCTTTATGCTATAATTTAGG + Intronic
981792081 4:148549529-148549551 TCCTCTATATGCTGTAATGGTGG + Intergenic
982537645 4:156626714-156626736 CTCCCTTTATGGTAGAATGGTGG - Intergenic
998624637 5:143832271-143832293 CACTCTGTATTTTATATTGGAGG - Intergenic
1001149528 5:169215031-169215053 CATTCTTTCTGCAATAAAGGTGG - Intronic
1005724623 6:28636245-28636267 TACTCTGTATACTATAATGGTGG - Intergenic
1006076137 6:31533892-31533914 CACTTTTTATACTATCCTGGGGG + Intronic
1006784101 6:36653375-36653397 CACTCTTTAAGCCTTCATGGTGG - Intergenic
1009374039 6:62945561-62945583 CACTGCTTATGCTATAGTAGTGG + Intergenic
1012503047 6:99912009-99912031 CACTGATTATACTATAATAGAGG + Intergenic
1012758839 6:103269447-103269469 CACTCCTTTTACTAAAATGGTGG - Intergenic
1015608721 6:134990545-134990567 AACTCTTTATGGAATTATGGTGG - Intronic
1020336492 7:7066314-7066336 CACACTTTCTGCGATACTGGGGG - Intergenic
1022866735 7:34429521-34429543 GAGTCTTTATGTTCTAATGGAGG - Intergenic
1024918253 7:54527757-54527779 CATTCTTTATGCTGTAAAGTTGG + Intergenic
1026649457 7:72202774-72202796 CACACTGTCTTCTATAATGGTGG - Intronic
1030594109 7:111515803-111515825 TAAGCTTTATGTTATAATGGGGG - Intronic
1033963304 7:146941527-146941549 CTATCTTCATACTATAATGGCGG - Intronic
1044513572 8:93112272-93112294 CTCTCTTTATGCTAAAATCAAGG - Intergenic
1048253194 8:132884258-132884280 CACTGTTTCTGCTTTAATGTTGG - Intronic
1050926549 9:11270199-11270221 CCTTCTTTATGCTATGTTGGGGG - Intergenic
1051107973 9:13603054-13603076 CAGTCTTTAGGCTTTAGTGGTGG + Intergenic
1052544471 9:29857084-29857106 CACTATTTTTGGTATAATGTAGG - Intergenic
1055105330 9:72506216-72506238 CACTCTTCATATAATAATGGGGG - Intergenic
1060656711 9:125376981-125377003 CACCATTTATCCTGTAATGGTGG - Intergenic
1185609380 X:1385512-1385534 CACTGTTCATGCTGGAATGGGGG + Intergenic
1186699531 X:12075161-12075183 TACTCTATATATTATAATGGTGG + Intergenic
1190949242 X:55126649-55126671 CATCCTTAATGTTATAATGGTGG - Intronic
1193061201 X:77209519-77209541 CAGTCTTTATGTTTTAATTGGGG + Intergenic
1193839267 X:86388803-86388825 AACTCTGTATGGGATAATGGTGG + Intronic
1194525763 X:94975956-94975978 AACTCTTTGTGCTATTATGTTGG + Intergenic
1199026418 X:142943789-142943811 CAACTTTTATGCTAAAATGGAGG + Intergenic