ID: 1098268331

View in Genome Browser
Species Human (GRCh38)
Location 12:68746133-68746155
Sequence TGGCTGCGGGCGGAGATGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098268319_1098268331 26 Left 1098268319 12:68746084-68746106 CCGTTCAGCCAGCGGCTCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1098268331 12:68746133-68746155 TGGCTGCGGGCGGAGATGAGCGG 0: 1
1: 0
2: 2
3: 11
4: 219
1098268322_1098268331 18 Left 1098268322 12:68746092-68746114 CCAGCGGCTCGGGGGCGGAAGCA 0: 1
1: 0
2: 0
3: 12
4: 284
Right 1098268331 12:68746133-68746155 TGGCTGCGGGCGGAGATGAGCGG 0: 1
1: 0
2: 2
3: 11
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098268331 Original CRISPR TGGCTGCGGGCGGAGATGAG CGG Exonic
900337101 1:2169709-2169731 TGGGTGCGCGCGGAGTTGGGGGG + Intronic
900666420 1:3818304-3818326 TGGCTGCAGGTGGAAATGTGGGG - Intronic
902330084 1:15727075-15727097 TGGCTGCAGGCGGGGTGGAGTGG - Exonic
903034149 1:20484138-20484160 AGGCTAGGTGCGGAGATGAGCGG + Intronic
903233840 1:21937261-21937283 CGGCTGCGGGCGGCGCGGAGCGG - Exonic
905243439 1:36596161-36596183 TGGCTGTGGACGGTGAGGAGGGG + Intergenic
905912710 1:41664722-41664744 TGGCTGGGGGCTGGGATGAAAGG + Intronic
907906077 1:58784453-58784475 CGGCTGCGGACGGGGATGCGGGG + Intergenic
914713448 1:150235345-150235367 TGGCTGCGGCAGGGGCTGAGTGG + Intronic
915651400 1:157313666-157313688 TTGCTGTGGGAGGATATGAGTGG + Intergenic
915676598 1:157537884-157537906 TGGCTGCAGGAGCAGATGAAAGG - Intronic
916660873 1:166921377-166921399 TGGCTGCGGGCAGAGAAGGAGGG + Exonic
920245617 1:204585451-204585473 TGGCTGCGGGTGCAGATGGAGGG - Intergenic
920645906 1:207804318-207804340 TGGGTGGGGGCGGGGCTGAGGGG - Intergenic
920670468 1:208000230-208000252 GGGCTGAGGGCAGAGGTGAGAGG + Intergenic
922129844 1:222766746-222766768 TGGGTGCGGGCTGAGGTGGGAGG + Intergenic
922577729 1:226673968-226673990 TGGCTGGGGGCAGAGCTGGGAGG + Intronic
922588510 1:226754085-226754107 TGGCTGCTGGTGGAGAACAGAGG + Intergenic
922803417 1:228374104-228374126 TGGGTGCGGGAACAGATGAGGGG + Intronic
922925221 1:229342493-229342515 AGGCTGCGGGCAGCGAGGAGCGG - Exonic
1062949291 10:1485476-1485498 AGGCTGCGTGCGGAGCTGCGTGG - Intronic
1064139391 10:12777790-12777812 TGGCTGCGGAAGGAGGTGAGTGG - Intronic
1064571387 10:16697289-16697311 TGTCTGTGGGCAGAGATTAGAGG - Intronic
1067462169 10:46465943-46465965 TGCCTGCGTGCGGAGTGGAGCGG + Intergenic
1067841456 10:49682815-49682837 GGGCTGGGGGTGGAGGTGAGAGG - Intronic
1071086788 10:81875137-81875159 GGGCGGCGGGCGGGGAGGAGAGG - Intergenic
1072634496 10:97169273-97169295 AGGCTGCGGGCTGGGCTGAGGGG - Intronic
1072710976 10:97715230-97715252 TGGGGGAGGGTGGAGATGAGGGG - Exonic
1073122475 10:101131216-101131238 TGGCTGTGCGCGGAGAGGAGCGG - Exonic
1073589760 10:104745738-104745760 TGTCTGGGGGCTGGGATGAGGGG - Intronic
1074314456 10:112349019-112349041 TGCCTGAAGGCAGAGATGAGAGG + Intergenic
1074815242 10:117137569-117137591 GGGCTGCGGGGGGAGATGAGGGG - Intronic
1074824594 10:117205619-117205641 TGGCTGAGGTGGGAGCTGAGAGG - Intronic
1075095517 10:119468502-119468524 GGGGTGGGGGGGGAGATGAGGGG - Intergenic
1075863226 10:125695819-125695841 AGGCTGTGGGAGGAGCTGAGGGG + Intergenic
1076139066 10:128065110-128065132 TGGCTCCGGGCGGGGCTGCGGGG - Intronic
1076514684 10:131037284-131037306 TGGCAGCGGAAGGAGAGGAGTGG + Intergenic
1076873480 10:133204883-133204905 TGGCTGGGGGCAGAGGTGAGAGG - Intronic
1077226373 11:1440644-1440666 TGGCTGGGGGGGCAGCTGAGAGG - Intronic
1077610616 11:3641546-3641568 TGCCTGCGCTGGGAGATGAGAGG + Intronic
1077916158 11:6612633-6612655 GGGCAGCTGGCGGAGAAGAGAGG - Exonic
1080036693 11:27719208-27719230 TGGCGGTGGGTGGAGGTGAGGGG - Intronic
1083408883 11:62478158-62478180 AGGCTGCGGGTGGTGGTGAGAGG - Intronic
1083618388 11:64037132-64037154 AGGCTGGGGACGGAGGTGAGGGG + Intronic
1083645074 11:64167356-64167378 TGGGGGCGGGTAGAGATGAGGGG - Intergenic
1083936624 11:65872901-65872923 TGGCCGGGGGCGGAGAAGCGGGG - Exonic
1084145396 11:67262488-67262510 AGGCTGGAGGCGGAGAAGAGAGG + Intergenic
1084888386 11:72224678-72224700 GGGCTGCGGGCCGAGCGGAGGGG + Intronic
1084892777 11:72244563-72244585 TCGCTGGGGGCGGGGCTGAGGGG - Intronic
1085474839 11:76783286-76783308 TGGCTGCGGGCGGGGACCGGGGG + Intronic
1085928890 11:81056734-81056756 TTGCTGCGGGAGGGGATGAGTGG - Intergenic
1086888277 11:92226905-92226927 AGTCTGGGGGCGGAGAGGAGCGG - Intergenic
1088289742 11:108223101-108223123 TGGCCGCGGGAGGAGGCGAGAGG + Exonic
1088843076 11:113643059-113643081 TGGCTGAGTGGGGAGAAGAGGGG - Intergenic
1089534915 11:119154949-119154971 TGGCTCAGGGCCGAGAGGAGAGG - Intronic
1089689082 11:120175395-120175417 TGAGTGGGGGCGGAGAAGAGAGG - Intronic
1090553157 11:127844992-127845014 TGCCTGCTGGTGGAGATGAATGG - Intergenic
1090621933 11:128568128-128568150 TGGCTCTGGGAGGAGGTGAGTGG + Intronic
1091121399 11:133060807-133060829 TGGCTGCATGCAGAGATGACAGG + Intronic
1091634905 12:2189542-2189564 TGGCTGCTGCGCGAGATGAGGGG + Intronic
1091636249 12:2199130-2199152 TGGCTGGGAGGGGAGTTGAGGGG - Intronic
1092247878 12:6873413-6873435 CGGCCGTGGGCGGCGATGAGAGG - Intronic
1096781138 12:53992788-53992810 TGCCTGCGGGCGGAGTTGGGGGG + Intronic
1098268331 12:68746133-68746155 TGGCTGCGGGCGGAGATGAGCGG + Exonic
1099673956 12:85732918-85732940 TGGCTGAGTGAAGAGATGAGCGG + Intergenic
1100126091 12:91427500-91427522 AGGCTACGGGTGGAGATGGGGGG + Intergenic
1101393812 12:104326012-104326034 TGGTTGCGTGGGGAGATGAAAGG - Intronic
1102418563 12:112786001-112786023 TGGCTGCTTCAGGAGATGAGCGG + Intronic
1103052415 12:117791650-117791672 TGGCTGCTGGAGGAGGTGGGAGG + Intronic
1103085821 12:118061195-118061217 TGGGCGCGGGCGGAGACGCGCGG + Intronic
1103858862 12:123995564-123995586 TGGAGGTGGGCGGAGATGGGTGG + Intronic
1104986180 12:132598675-132598697 TGACTGTGGGTGGAGAGGAGGGG - Intergenic
1106798376 13:33231194-33231216 GGGCTGGGAGTGGAGATGAGGGG + Intronic
1106878360 13:34101830-34101852 TAGCTGAGGGCGAATATGAGGGG - Intergenic
1117105579 14:52394552-52394574 TGGCCGTGGGCAGATATGAGGGG - Intergenic
1118734217 14:68690541-68690563 GAGCTGCGGGCAGGGATGAGCGG - Intronic
1118948109 14:70407784-70407806 TAGCTGTGGGCGGGGATGATAGG - Intronic
1121648135 14:95535075-95535097 GGCTTGCGTGCGGAGATGAGCGG + Exonic
1122077528 14:99245858-99245880 TGGCAGCCGGCGGAGATGGATGG - Intronic
1122519567 14:102333964-102333986 TGGCAGGGGAGGGAGATGAGGGG - Intronic
1122817448 14:104320676-104320698 GGGCTGTGGGTGGTGATGAGGGG - Intergenic
1122896188 14:104758271-104758293 TGGCTGCCGGTGGCGGTGAGGGG + Intronic
1124696864 15:31870711-31870733 CGGCCGCGGGCGGAGCGGAGGGG - Intronic
1125653677 15:41338428-41338450 TGGCTGTGGGTGAAGAAGAGAGG - Intronic
1128233945 15:66054381-66054403 TGGGGGCAGGTGGAGATGAGGGG - Intronic
1131193605 15:90337205-90337227 TGGCTGCTGGAGGAGTTGGGCGG - Intergenic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1132723958 16:1330862-1330884 TGGCGGGGGGCGGAGATGGGGGG - Intergenic
1133023428 16:2976870-2976892 TGGCAGGGGGCGGAGGTGGGAGG + Exonic
1136009935 16:27356883-27356905 AGGCTGAGGGAGGAGATGAGTGG + Intronic
1136237770 16:28925122-28925144 TGGCCGCGGACGACGATGAGCGG - Exonic
1137592533 16:49702566-49702588 GGGCTGGGGGTGGAGGTGAGGGG - Intronic
1141433241 16:83981660-83981682 TAGCTGCTGGCTGGGATGAGTGG + Intronic
1141694606 16:85613608-85613630 TGGCTGCGGGCGGGGACTCGGGG + Intronic
1142665554 17:1461376-1461398 AGGCTGGGGGCAGAGAAGAGTGG - Intronic
1142720401 17:1771979-1772001 TGGGTGCAGGCGCAGATGAAAGG + Exonic
1143091767 17:4453116-4453138 AGGCTGGAGGCGCAGATGAGGGG - Exonic
1144152578 17:12464341-12464363 TGGCTGGGGGCAGGGGTGAGAGG + Intergenic
1144853336 17:18254942-18254964 TGGGTGTGGGGGTAGATGAGGGG + Intronic
1145280790 17:21465462-21465484 TGACTGAGGGCTGAGAGGAGGGG + Intergenic
1145397121 17:22505102-22505124 TGACTGAGGGCTGAGAGGAGGGG - Intergenic
1146063387 17:29618436-29618458 TGGGTGCCGGCTGAGAGGAGAGG + Intronic
1146638621 17:34524062-34524084 AGGCTGTGGGAGGAGAGGAGAGG - Intergenic
1147149905 17:38508717-38508739 TGGCTGTGGGTGGAGGAGAGAGG + Intronic
1147793041 17:43025179-43025201 TGGCTGGGGGCGGGGCGGAGGGG + Intergenic
1148240465 17:45996676-45996698 TGGCTGCGCGTGGAGGTGTGGGG + Intronic
1152546670 17:81003861-81003883 TGGCTGCGAGCGGAGCTGCTAGG + Intronic
1153051217 18:905039-905061 TGGCAGCGGGAGGAGTTGAAGGG + Intronic
1155600724 18:27543844-27543866 GGTCTGCGGGCAGAGGTGAGGGG - Intergenic
1157179176 18:45480551-45480573 TGGCTGTGGGCAGAGATGGCTGG - Intronic
1157529454 18:48409218-48409240 CGGCGGCGCGCGGAGGTGAGCGG - Intronic
1158893656 18:61894526-61894548 GGGCTGTGGGCGGGGAGGAGGGG - Intergenic
1158913110 18:62087844-62087866 TTGCTGAGGGCTGAGAGGAGTGG + Intronic
1160798097 19:954938-954960 GGGCTGAGGGCCGAGATAAGCGG - Intronic
1161052030 19:2169151-2169173 CGGCTGTGGGCGGCGGTGAGTGG + Intronic
1161400513 19:4065007-4065029 TGGCTGGGGGCTGAGCGGAGCGG - Intronic
1161820897 19:6530931-6530953 TGGCCGCGGGCGGAGGGGCGTGG + Intergenic
1161820905 19:6530951-6530973 TGGCCGCGGGCGGAGGGGCGTGG + Intergenic
1163547627 19:17949130-17949152 TGGCTGGGGGAGGGGATGACGGG - Intergenic
1165006097 19:32808441-32808463 TGGCTGCTGGCGGAGATGCAAGG - Intronic
1165139790 19:33691836-33691858 GGGCTGGGAGTGGAGATGAGCGG + Intronic
1165454369 19:35902192-35902214 TGTCTGCTGGCAGAGATGAAAGG - Intronic
1165814380 19:38632645-38632667 TGGCTGCTGGCCGAGATGCTCGG + Exonic
1166361553 19:42254768-42254790 TGGCTCCGGGCGGAGTGGTGTGG - Intronic
1167269571 19:48499474-48499496 GGGCTGCGGGCGCTGATGACAGG + Exonic
1168044793 19:53786861-53786883 TGGCTTGGGGCGGAGACCAGGGG + Intergenic
925313758 2:2906671-2906693 TGGCTGTGGGCTGGGAAGAGGGG - Intergenic
925313774 2:2906716-2906738 TGGCTGCGGGCTGGGGAGAGGGG - Intergenic
925313792 2:2906762-2906784 CGGCTGCGGGCTGGGAAGAGGGG - Intergenic
925313847 2:2906899-2906921 TGGCTGTGGGCTGGGAAGAGGGG - Intergenic
926138983 2:10357223-10357245 TGGCTGAGGTGGGACATGAGAGG + Intronic
926269923 2:11357635-11357657 CGGCTGCGGCCAGAGATGAAAGG + Intergenic
926337430 2:11875101-11875123 AGGGTGGGGGCGGAGGTGAGGGG - Intergenic
929746019 2:44659440-44659462 TGGCGGAGGGCGGAGTTCAGTGG + Intronic
929808675 2:45169979-45170001 TGCCTGCGGGCGGCGGTGTGCGG - Intergenic
933778677 2:85787051-85787073 TGGGTGAGGGCGGAGGGGAGAGG - Exonic
935065346 2:99642679-99642701 TGGCTGGGGTCGGAGATAGGAGG - Intronic
936144412 2:109970215-109970237 TGGCTGTGGGCGGGGCTGACTGG - Intergenic
936200276 2:110401254-110401276 TGGCTGTGGGCGGGGCTGACTGG + Intergenic
936267493 2:111021626-111021648 AGGCTGCGGGTGGAGAGGGGAGG + Intronic
937306754 2:120876433-120876455 TGGCTGCTGGAGCAGCTGAGCGG - Intronic
937427229 2:121810394-121810416 TGGCTGTGGATGGGGATGAGAGG - Intergenic
938157461 2:128953304-128953326 TGGCTGGGGGCGGGGAGGGGTGG + Intergenic
938578349 2:132623932-132623954 GGGCTGCTGGTGGAGGTGAGGGG - Intronic
941468128 2:165854559-165854581 TGGCTGTGGCTGGTGATGAGAGG + Intergenic
941819099 2:169827373-169827395 GGGCTGCGGGCGGAGGAGCGCGG + Intergenic
946237521 2:218333094-218333116 TGGCTGGGGGTGGAAAAGAGTGG - Intronic
946310225 2:218879131-218879153 TGGCTGCCGGCAGAGATGAGGGG + Intergenic
946394225 2:219435158-219435180 CGGCTGCGGGTGGTGGTGAGCGG + Exonic
946864588 2:224031513-224031535 TGGCTGTGGGCGGAGGAGGGAGG - Intronic
947749078 2:232523557-232523579 TGGCTCCAGGAGCAGATGAGCGG + Exonic
948772223 2:240257473-240257495 TGGCTGTGGCTGGAGATGATTGG - Intergenic
1171276111 20:23857810-23857832 TGGCTGCAGGAGGAGAAAAGAGG + Intergenic
1172177468 20:32980935-32980957 TGGCTGTGGGAAGAGTTGAGGGG + Intergenic
1172768060 20:37361533-37361555 TGGGTGTGGGCGGGGAGGAGGGG + Intronic
1172774522 20:37399244-37399266 TGGCAGGAGGCGGAGGTGAGAGG + Intronic
1173795001 20:45853760-45853782 TGACTGGGGGCCGAGAAGAGGGG + Intronic
1173834166 20:46114223-46114245 TGGCTGAAGGCAGAGATTAGGGG + Intergenic
1175111536 20:56651811-56651833 TGGCTGGGGGCAGAGTTGTGAGG - Intergenic
1176071613 20:63229576-63229598 TGGCTGAGAGCGGAGATGGAGGG - Intergenic
1176250954 20:64119693-64119715 TGGCTGCTCGGGGAGGTGAGTGG + Intergenic
1176293502 21:5058745-5058767 TGGGTGCTGGCGGAGTGGAGCGG - Intergenic
1176310186 21:5145230-5145252 TGGCTGCGTGCGGAGGTGGGCGG - Intronic
1178480796 21:32978061-32978083 TGGCTTGGGGTGGAGAAGAGAGG - Intergenic
1179213603 21:39348702-39348724 TGGCGGCCGGGGGAGCTGAGGGG - Intronic
1179846870 21:44116806-44116828 TGGCTGCGTGCGGAGGTGGGCGG + Intronic
1179863758 21:44204903-44204925 TGGGTGCTGGCGGAGTGGAGCGG + Intergenic
1181804790 22:25368172-25368194 TGGCTGCGGACGGTGAGGTGAGG - Intronic
1183410767 22:37653880-37653902 TGGCTGTGGGAGGGGAGGAGGGG + Intronic
951616803 3:24556292-24556314 TGGCTGCTGGCTGAGATGCTCGG + Intergenic
955358052 3:58247948-58247970 GGGCTGGGGACAGAGATGAGAGG - Intronic
959566028 3:107834166-107834188 TGGCTGCGGAGTGAGATGAAGGG - Intergenic
962324617 3:134422967-134422989 TGGGTGCAGGCTGAGAGGAGAGG - Intergenic
962407829 3:135115438-135115460 TGCCTGGGGGAGGAGGTGAGAGG - Intronic
965571958 3:170181758-170181780 CGGCGGCGGGCGGAGAGGCGGGG + Intergenic
969250167 4:5962570-5962592 TGGATGGGGGCGGGGTTGAGAGG - Intronic
982288368 4:153757600-153757622 TGCCTGTGGGTGGAGAGGAGGGG + Intronic
985867855 5:2529306-2529328 TGGCTGCAGTCGGAGAGGTGAGG + Intergenic
986449303 5:7850266-7850288 TGGGAGCGTGCGGAGATGAAGGG - Intronic
987145093 5:14984070-14984092 TTGCTGTGGGCGGAGAGGGGAGG - Intergenic
987915919 5:24214246-24214268 TGGTTGCGAGGGGATATGAGAGG - Intergenic
989102275 5:37834580-37834602 TGGCTGCGGGTGGGGGTGCGAGG + Intronic
994692156 5:103032840-103032862 TGGCTGCTGGCCGAGATGCCTGG + Intergenic
999622918 5:153490591-153490613 AGGCTGCGAGGGGAGAGGAGAGG + Intronic
1001600846 5:172927100-172927122 TGTCTGCGTGTGGAGATGTGCGG - Intronic
1003637298 6:7844604-7844626 TGGCTGCGGGTGGGGAAGGGGGG - Intronic
1004924501 6:20403778-20403800 TGGCTCCGGGGGGAGGTGGGGGG - Intronic
1005563742 6:27068182-27068204 TGGCTGAGGGCTGAGGTGGGAGG - Intergenic
1006258152 6:32847481-32847503 TGGCTGGGTGGTGAGATGAGTGG + Intronic
1006598275 6:35209272-35209294 TGGATGTGGGCAGAGAGGAGGGG + Intergenic
1007465547 6:42048852-42048874 GGGCTGCGGGCGGGGGTGCGCGG - Intronic
1010553018 6:77246087-77246109 AGGCTGAGTGTGGAGATGAGGGG + Intergenic
1011427588 6:87247242-87247264 TGGCAGGGGGCGGTGGTGAGGGG - Intronic
1012401424 6:98845270-98845292 TCGCTGCGGGCGGCGAGGGGCGG - Intergenic
1019032611 6:169025382-169025404 TCGCTGCGGGCAGAGCAGAGGGG - Intergenic
1019703817 7:2488079-2488101 TGGCTGGGGGCGGGGGAGAGGGG - Intergenic
1020083022 7:5296621-5296643 TGAGTGGGGGCGGAGCTGAGTGG + Intronic
1020256045 7:6503685-6503707 TGGCTGCGGGCGGGGCGGGGCGG + Exonic
1022242975 7:28530794-28530816 GGACTGCGGGTGGAGATGAGTGG - Intronic
1022960722 7:35423892-35423914 TGGCTGGGGGAGGATAGGAGAGG - Intergenic
1023638469 7:42236652-42236674 TGGATGGGGGCGGAGGCGAGGGG + Intronic
1023955756 7:44885460-44885482 CGGCGGCGGCCGGCGATGAGCGG - Intergenic
1025211257 7:57020571-57020593 TGAGTGGGGGCGGAGCTGAGTGG - Intergenic
1025660697 7:63556276-63556298 TGAGTGGGGGCGGAGCTGAGTGG + Intergenic
1025665345 7:63580286-63580308 TTGCTGCAGGAGGTGATGAGAGG - Intergenic
1025990609 7:66494031-66494053 TGGCTGGGGGAGGAGTTGGGGGG - Intergenic
1027213267 7:76167024-76167046 TGGCTGGGGGAGGAGTTGGGGGG - Intergenic
1029403245 7:100358207-100358229 TGCCTGAGGGCTGAGGTGAGTGG - Exonic
1029479499 7:100803980-100804002 TGGCTGGAGGCTGAGATAAGGGG + Intronic
1031048600 7:116921792-116921814 TGGCTGAGGGGAGAGAGGAGAGG + Exonic
1032016072 7:128381115-128381137 GGGCTGCTGGGGGAGAAGAGAGG + Intergenic
1036176485 8:6543095-6543117 TGGCTGGGGGTGGAGTTGCGGGG - Intronic
1037390297 8:18386245-18386267 TGGCAGAGGGTGGAGCTGAGTGG - Intergenic
1039493604 8:37965421-37965443 GGGCTGCGGCAGTAGATGAGCGG + Exonic
1039695590 8:39906964-39906986 AGGCTGAGGGCTGAGATGGGAGG + Intronic
1039887182 8:41661551-41661573 TGTCTGCAGGTGGAGCTGAGAGG - Intronic
1041374075 8:57194033-57194055 GGGCTGCGGGAGGAGGTGGGCGG + Intergenic
1041750812 8:61259248-61259270 TGGCTGAGGGCTGACATGAAAGG + Intronic
1042916167 8:73878317-73878339 TGGCTGCGGACGGCGCTTAGCGG - Intronic
1044842302 8:96346851-96346873 TGGCCGGGGACAGAGATGAGGGG - Intergenic
1049419558 8:142510793-142510815 CGGCTGCGGGCGCAGGTGCGGGG + Intronic
1049724911 8:144141345-144141367 TGGGTGCTGGAGGTGATGAGAGG - Intergenic
1056317736 9:85407623-85407645 TTGCTGAGGGCGGGCATGAGGGG + Intergenic
1058223485 9:102331455-102331477 TGGCTGCTGGCTGATAAGAGGGG + Intergenic
1059642800 9:116234231-116234253 TCGCTGCAGGCTGAGATCAGTGG + Intronic
1060017515 9:120099369-120099391 TGGCTGCTGGAGGATGTGAGAGG + Intergenic
1061551421 9:131336956-131336978 TGGGGGCCGGAGGAGATGAGGGG + Intergenic
1194112589 X:89853792-89853814 AGGCTGCTTGAGGAGATGAGAGG + Intergenic
1197198934 X:123732441-123732463 CGGCAGCGGGCGAAGAGGAGGGG + Intronic
1197746428 X:129934485-129934507 TGGCTGGGGGTGGAGGTGTGAGG - Intergenic
1197871646 X:131067573-131067595 TGGTTGGGGGCGGGGACGAGTGG - Intronic
1200465242 Y:3508604-3508626 AGGCTGCTTGAGGAGATGAGAGG + Intergenic
1201073156 Y:10168536-10168558 TGGCTGAGGGTGGGGAGGAGGGG + Intergenic