ID: 1098268338

View in Genome Browser
Species Human (GRCh38)
Location 12:68746172-68746194
Sequence CGGCGTCCTAGCTGGCTTAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098268329_1098268338 26 Left 1098268329 12:68746123-68746145 CCGAGTCACGTGGCTGCGGGCGG 0: 1
1: 0
2: 1
3: 2
4: 70
Right 1098268338 12:68746172-68746194 CGGCGTCCTAGCTGGCTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 31
1098268327_1098268338 28 Left 1098268327 12:68746121-68746143 CCCCGAGTCACGTGGCTGCGGGC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1098268338 12:68746172-68746194 CGGCGTCCTAGCTGGCTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 31
1098268328_1098268338 27 Left 1098268328 12:68746122-68746144 CCCGAGTCACGTGGCTGCGGGCG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1098268338 12:68746172-68746194 CGGCGTCCTAGCTGGCTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098268338 Original CRISPR CGGCGTCCTAGCTGGCTTAC AGG Exonic
903892365 1:26578217-26578239 TGGTGTCCTAGTTGGCTTCCTGG - Intergenic
904008462 1:27376200-27376222 CTGCGTCCTCCCTGGCTTCCCGG - Intergenic
905060470 1:35135539-35135561 CGGCGTCCGTGCTGGTTTAGGGG + Intergenic
905985939 1:42282244-42282266 AAGCTTCCTAGCTGGCTTCCTGG + Intronic
918484571 1:185015787-185015809 CAGTGTCCTAGCTGGCTGAAAGG - Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1062898111 10:1120385-1120407 GGGGGTCCTGGCTGGCTTATTGG + Intronic
1080207973 11:29753121-29753143 CAGCATCCCAGCTGGCTTCCCGG - Intergenic
1090326027 11:125887311-125887333 CGGCGACATAGCTGGCTTTTTGG - Exonic
1098268338 12:68746172-68746194 CGGCGTCCTAGCTGGCTTACAGG + Exonic
1116817591 14:49598533-49598555 ATGCGCCCTCGCTGGCTTACGGG + Intronic
1127575399 15:60286999-60287021 TGGTGTCCTAGCTGGACTACTGG - Intergenic
1130115569 15:81001995-81002017 CGGCCTCCTAGAGGGCTTGCAGG - Exonic
1131470850 15:92695637-92695659 CTGAAGCCTAGCTGGCTTACAGG - Intronic
1142483383 17:231897-231919 GGGCCTCCTCGCTGGCTTAGAGG - Intronic
1158439906 18:57466511-57466533 CGACTTCCTGGATGGCTTACAGG + Intronic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
948055867 2:235008941-235008963 CGGGGTTCCAGCTGGCTTACAGG + Intronic
1169142493 20:3234251-3234273 CCGCGACCTAGATGGCTTCCTGG - Exonic
1170820650 20:19754362-19754384 CGGCGTCCGTGATGGCCTACGGG + Intergenic
1171816707 20:29792342-29792364 CGGAGTGCTCGCTGGCTTACTGG + Intergenic
1172021270 20:31916027-31916049 CCCCTTCCTAGCTGGCTCACTGG + Intronic
1180320178 22:11312950-11312972 CAGAGTGCTCGCTGGCTTACTGG + Intergenic
953464658 3:43109066-43109088 CTGGGTCCTAGGTGACTTACAGG - Intergenic
961858542 3:129895334-129895356 TGGCCTCCTAACTGGCTTCCCGG - Intergenic
965286689 3:166827320-166827342 CGGCGTCCTTGATGGTCTACGGG + Intergenic
980092174 4:128454519-128454541 CGCCCTCCTAACTGGCTTTCAGG - Intergenic
1006626001 6:35398237-35398259 CAGCCTCCTAACTGGCTTTCTGG - Intronic
1011994804 6:93572382-93572404 CTGCCTCCTGGCTGGCTTAAGGG + Intergenic
1018941073 6:168309039-168309061 CGGCGTCCGCGCTGGCTTTCTGG + Exonic
1045423282 8:102038437-102038459 CAGCATCCTTGCTGGCTTACAGG - Intronic
1049778009 8:144415332-144415354 CGGCGTCCTGGCTGCCCTGCTGG - Exonic
1049882482 8:145075738-145075760 CGGAGTGCTCGCTGGCTCACTGG - Intergenic
1051257794 9:15232804-15232826 CGGCGACGTAGCTGGCTTTTTGG + Intronic
1203368398 Un_KI270442v1:278704-278726 CGGAGTGCTCGCTGGCTTACTGG + Intergenic
1192313547 X:70035202-70035224 AGGCGTGCTAGCTGGCCAACAGG - Intronic
1197958475 X:131978483-131978505 GGGCTTCCTAGTTGTCTTACTGG - Intergenic
1199863390 X:151821797-151821819 CGGCTTCCTGACTGACTTACTGG - Intergenic