ID: 1098268832

View in Genome Browser
Species Human (GRCh38)
Location 12:68750615-68750637
Sequence CTGGAACAGCAGGGGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098268832_1098268841 15 Left 1098268832 12:68750615-68750637 CCTGAGAGCCCCTGCTGTTCCAG 0: 1
1: 0
2: 4
3: 32
4: 276
Right 1098268841 12:68750653-68750675 AGACACGCGGCTGCCTGAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 80
1098268832_1098268842 25 Left 1098268832 12:68750615-68750637 CCTGAGAGCCCCTGCTGTTCCAG 0: 1
1: 0
2: 4
3: 32
4: 276
Right 1098268842 12:68750663-68750685 CTGCCTGAAGAGGCTGCAAAAGG 0: 1
1: 0
2: 2
3: 23
4: 291
1098268832_1098268839 2 Left 1098268832 12:68750615-68750637 CCTGAGAGCCCCTGCTGTTCCAG 0: 1
1: 0
2: 4
3: 32
4: 276
Right 1098268839 12:68750640-68750662 AGTCCTGTGGCGAAGACACGCGG 0: 1
1: 0
2: 0
3: 5
4: 49
1098268832_1098268844 30 Left 1098268832 12:68750615-68750637 CCTGAGAGCCCCTGCTGTTCCAG 0: 1
1: 0
2: 4
3: 32
4: 276
Right 1098268844 12:68750668-68750690 TGAAGAGGCTGCAAAAGGAAAGG 0: 1
1: 0
2: 4
3: 46
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098268832 Original CRISPR CTGGAACAGCAGGGGCTCTC AGG (reversed) Intronic
900073465 1:792294-792316 CTGGAAAAGCAGGGCATCCCTGG - Intergenic
900547178 1:3235636-3235658 CTCCATCAGCAGGGGCTCCCAGG + Intronic
900590664 1:3458056-3458078 ACGGAACACCAGGGCCTCTCTGG + Intronic
900644105 1:3701211-3701233 GGGGAAGAGCAGGTGCTCTCGGG - Intronic
900890805 1:5448368-5448390 CAGGGGCAGGAGGGGCTCTCTGG + Intergenic
903072467 1:20733045-20733067 CTGGAACTCCAGGGGCCCTCAGG - Intergenic
904410933 1:30324557-30324579 CAGGCAGAGCAGGGGCTGTCTGG + Intergenic
904600827 1:31671702-31671724 CTGGAATCCCAGGGGCTCTATGG - Intronic
904619480 1:31766677-31766699 CTGGAAGGGCAGGGGCTCCTGGG - Intergenic
904828895 1:33294352-33294374 CAGGGACAGAAGGAGCTCTCAGG + Intronic
905076174 1:35272537-35272559 CTAGTACAGCAGAGGCTCTATGG + Intronic
905899884 1:41574480-41574502 ACTGACCAGCAGGGGCTCTCAGG - Intronic
906053931 1:42899778-42899800 CTGCCACAGCAGATGCTCTCTGG - Intergenic
908420128 1:63951516-63951538 CTGGCACAGCAGGTGCCATCAGG + Intronic
908798923 1:67858882-67858904 CTGGTTCAGCAGGGGCTCTCAGG - Intergenic
912680825 1:111727686-111727708 CTGGAACAGCTGGAGATCTCTGG - Exonic
914827665 1:151146934-151146956 CTGGCACAGGAGAGGCTCTGGGG + Intergenic
919822904 1:201484134-201484156 CTGGAGAAGCAGGGGCTCCTAGG + Exonic
920383253 1:205548297-205548319 CTGGAGGAACAGGGGCTCTCGGG - Intergenic
921395903 1:214669332-214669354 CTAGAACAGCAGCTGCTCCCAGG + Intergenic
923954715 1:239003094-239003116 ATGGAACTGCAGGGGCTCACTGG - Intergenic
924784857 1:247185234-247185256 CGGCCACACCAGGGGCTCTCTGG + Intergenic
1063031622 10:2240833-2240855 CTCGAGCATCAGGGGCTCTGAGG - Intergenic
1063099783 10:2939448-2939470 CTGGAACAGGAAGGACTTTCAGG + Intergenic
1063479814 10:6365499-6365521 ATAGAACAGCATGGGATCTCGGG - Intergenic
1065745685 10:28839546-28839568 CTGGCCCAGCAGGGGAGCTCAGG - Intergenic
1069622131 10:69844174-69844196 AGGGAACAGCATGGGCTGTCAGG + Intronic
1070219281 10:74423498-74423520 CTGGAGCACCAGGTGCACTCTGG + Intronic
1070519350 10:77238308-77238330 GTGCAACAGCAGTGGGTCTCGGG + Intronic
1070662221 10:78315232-78315254 CTGGAACAGAATAGGCTCTTGGG + Intergenic
1070919115 10:80172904-80172926 ACGGGCCAGCAGGGGCTCTCAGG - Intronic
1071304982 10:84291605-84291627 CTAGGACAGCACTGGCTCTCTGG - Intergenic
1071569401 10:86688409-86688431 GTGGAACAGTGTGGGCTCTCTGG + Intronic
1072752055 10:97988148-97988170 AAGGGACAGCAGGGGCTGTCAGG - Intronic
1073185847 10:101614580-101614602 CGGGCAGAGCAGGGGCTCTCAGG - Intronic
1074346829 10:112694333-112694355 CTGGAACAGAATGGACACTCAGG + Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075597959 10:123746044-123746066 CTGGATCAGCAGGGACTTTGGGG + Exonic
1076290269 10:129340536-129340558 GGGGCAGAGCAGGGGCTCTCGGG - Intergenic
1076520582 10:131078449-131078471 CTGGCACAGAATGGGCTCTGCGG - Intergenic
1076746605 10:132517737-132517759 ATGGAACAGCAGGTCCTCGCGGG - Intergenic
1077138320 11:1012569-1012591 ATGGTGCAGAAGGGGCTCTCGGG + Intergenic
1077754563 11:5012521-5012543 ATGCAAAAGCAGGGGCTGTCTGG - Intergenic
1078025482 11:7691296-7691318 CGGGACCTGCAGGGGCTTTCAGG - Exonic
1080593266 11:33743002-33743024 CTGAAACAGCTGGGGCTCCTGGG + Intronic
1080723331 11:34870655-34870677 CTGGGGCAGCTGAGGCTCTCAGG - Intronic
1081508059 11:43738738-43738760 CTGTAAGAGCAGGGTCTGTCTGG - Intronic
1083316322 11:61816782-61816804 CCGGGCCAGCAGGGGCTGTCAGG + Exonic
1083353435 11:62047488-62047510 CTGGGTGAGCAGAGGCTCTCTGG - Intergenic
1083455768 11:62777785-62777807 CTGGAGCATCCGGGGCTCCCTGG - Intronic
1083756401 11:64793982-64794004 CTGCAACAGCTGGGGAGCTCAGG - Intronic
1084174154 11:67415116-67415138 CTGGCCCAGGAGGGCCTCTCTGG + Intronic
1084350932 11:68598597-68598619 GTGGAATGGCAGAGGCTCTCTGG - Intronic
1084565744 11:69927767-69927789 TGGGATCAGCAGGGCCTCTCAGG + Intergenic
1085730307 11:78992147-78992169 GTGCACCAGCAGGTGCTCTCAGG - Intronic
1089454831 11:118620151-118620173 CTGGAACAAGAGGAACTCTCTGG + Intronic
1089759668 11:120713972-120713994 CTGGAGAAGCAGGTGCTCTATGG - Intronic
1090276232 11:125421799-125421821 CTGGAGCAGCAAGGGCTCCCCGG - Intronic
1090280104 11:125448458-125448480 CTGGAGCAGAAGGGGTTCTCTGG - Intronic
1090613980 11:128497851-128497873 CTGGAACGGAAGAGCCTCTCTGG - Intronic
1091143740 11:133258911-133258933 GTGGAACAGCAGGGCCTGGCAGG + Intronic
1091773836 12:3171463-3171485 AGGGGACAGCAGGGGCTATCAGG - Intronic
1092251741 12:6902658-6902680 CTGGAACAGTAGGTGCAGTCGGG - Intronic
1094142868 12:27198939-27198961 CTGGAGCAACAGAGGCTCTGGGG - Intergenic
1094252612 12:28381895-28381917 TTGGAACTGCAGGGGACCTCTGG + Intronic
1096733666 12:53635427-53635449 CTGGAGTAGCAAGGACTCTCAGG + Intronic
1098268832 12:68750615-68750637 CTGGAACAGCAGGGGCTCTCAGG - Intronic
1100588499 12:96001355-96001377 CTGGTACAGAAGGAGGTCTCTGG - Intronic
1100789421 12:98114056-98114078 TTGGAACATCAGGGGCTCCATGG + Intergenic
1102028427 12:109726626-109726648 CAGGAGCAGCAGGGGGGCTCAGG + Intronic
1103870124 12:124085423-124085445 CTGGAACAGCCGTGGCACTAGGG - Intronic
1107359435 13:39603034-39603056 CTGGAAGAGCAGGGGTTGGCAGG + Exonic
1107451471 13:40514129-40514151 CTGGAACAGCTGGGGCTCCTTGG - Intergenic
1107695431 13:42994891-42994913 GAGGAACAGCAGGGCCTTTCTGG + Intergenic
1108268476 13:48735234-48735256 CTGGGACTGCAGGGTCTCTGAGG + Intergenic
1110298141 13:73893981-73894003 CTAGAACAACAAGGGCTCTTAGG + Intronic
1111393107 13:87625382-87625404 CTGGAACAGCAGGTGAACTGGGG - Intergenic
1114526774 14:23371464-23371486 CTGGGAAAGCAGGGGCACTCAGG - Intergenic
1115896222 14:38090731-38090753 ATGGAACAGCTGGGGCTGGCTGG - Intergenic
1116574014 14:46550849-46550871 CTGGAAAAGGAGGGGATTTCAGG - Intergenic
1116857293 14:49963959-49963981 CTGGAGCAGCAAGGGTGCTCTGG - Intergenic
1117693701 14:58337351-58337373 CTGTGAAAGCAGGGGATCTCAGG + Intronic
1118326721 14:64786363-64786385 CTGGGACAGGCGGGTCTCTCAGG - Intronic
1119077812 14:71661478-71661500 GTGTCACAGCAGGGGCTCTGTGG + Intronic
1119160560 14:72448985-72449007 CTGGTACACCATGGGCACTCAGG + Intronic
1121016188 14:90550774-90550796 CTGGTACAGAAGAGGCTCTTGGG + Intronic
1121474638 14:94186263-94186285 CTGGAATGGAAGGGGCTCACGGG - Intronic
1122531113 14:102427797-102427819 CTGCAACACCCAGGGCTCTCAGG - Intronic
1122684292 14:103492885-103492907 CTGAAACTGCAGGGGCTCTTGGG - Intronic
1122927019 14:104908747-104908769 CTGGAACAGCAGGTGCTGCCTGG + Intergenic
1123040033 14:105486687-105486709 GGGCAACAGCGGGGGCTCTCCGG + Intergenic
1125608190 15:40953879-40953901 CTGGAATGTCCGGGGCTCTCTGG + Intronic
1125729685 15:41886139-41886161 CCGGAAGAGCAGGGCCTCTGCGG + Exonic
1127262190 15:57334633-57334655 CTGGCGCTGCAGGGGCCCTCTGG + Intergenic
1127509158 15:59623268-59623290 CTGGAACTGCAGGCGTGCTCAGG + Intronic
1127886473 15:63205919-63205941 GTGGAAGAGCAGGAGCTTTCAGG + Intronic
1128178473 15:65579072-65579094 CCTGACCGGCAGGGGCTCTCTGG - Intronic
1128218305 15:65949659-65949681 CTGGAAGATAAGGGGCCCTCTGG - Intronic
1128603001 15:69013686-69013708 CTGAACCAGCAGGGGCTCACTGG - Intronic
1128786008 15:70397957-70397979 CTGGGACCACAGGGCCTCTCGGG + Intergenic
1128997494 15:72307465-72307487 CTGGCACAGAGTGGGCTCTCAGG - Intronic
1130199379 15:81810775-81810797 CTGGACCAGCAGGAGCTTTGTGG - Intergenic
1130484682 15:84392145-84392167 CTGGAACAGGAGAGGTTTTCGGG + Intergenic
1131184350 15:90262520-90262542 CAGGAACAGCAGGAGACCTCGGG + Intronic
1132702672 16:1228785-1228807 CTTGCACACCAGGGGCCCTCCGG + Exonic
1132705654 16:1242083-1242105 CTTGCACACCAGGGGCCCTCCGG - Exonic
1133344048 16:5058462-5058484 CTGGCACGGCGGGGGCTCCCTGG + Intronic
1135166272 16:20141849-20141871 CTGGACCACCAGGTGCTCTGGGG - Intergenic
1136748783 16:32614857-32614879 CTGGAACAGCAGGGTCTGAGTGG + Intergenic
1137373075 16:47926770-47926792 TTGGAACAGGAATGGCTCTCAGG + Intergenic
1137898407 16:52238388-52238410 GTGCCACAGCAGGGGCTTTCAGG - Intergenic
1139038105 16:62972411-62972433 CTGGAACAGCTGGGGCGCCTTGG + Intergenic
1139571596 16:67816402-67816424 GTGGAACAGCATGGGCTGTATGG + Intronic
1141447319 16:84069475-84069497 CAGCAACAGCAGTGGCACTCAGG + Intronic
1141490337 16:84368396-84368418 CTGGGACCCCAGGGGCTCTGGGG - Intergenic
1141686418 16:85572717-85572739 CTGGAGCAGCAGGGGCCCCTAGG - Intergenic
1142126996 16:88415195-88415217 CCGGAACATCAGGGACCCTCCGG + Intergenic
1203050916 16_KI270728v1_random:874071-874093 CTGGAACAGCAGGGTCTGAGTGG + Intergenic
1144051154 17:11498145-11498167 CTGGGGAAGCAGAGGCTCTCAGG + Intronic
1144641127 17:16937434-16937456 CTGGAACAGCCGGGGTTTTAGGG - Intronic
1145125716 17:20298478-20298500 CTGGATCAGCACAGCCTCTCTGG - Intronic
1147533645 17:41303213-41303235 GAGGAACAGCAGGGCCACTCTGG - Intergenic
1147586047 17:41654529-41654551 GGGGAACAGCAGGGACTCTGTGG + Intergenic
1148089375 17:45013667-45013689 GTGCCCCAGCAGGGGCTCTCTGG - Intergenic
1149576918 17:57720585-57720607 CTGGAACTGCAGGAGCCATCTGG + Intergenic
1150218872 17:63484750-63484772 CTGGAAGGGGAGGGGCCCTCAGG - Intergenic
1150457007 17:65314229-65314251 CTGACACAGCAGAGGGTCTCTGG + Intergenic
1152133617 17:78491682-78491704 GAGGAACAGCAGAGGCCCTCGGG + Intronic
1152201259 17:78947782-78947804 CTGGGAAAGCAGTGGCTCCCTGG + Intergenic
1152233737 17:79127742-79127764 CTGGAACAGCACGAGTTATCTGG + Intronic
1152477690 17:80528746-80528768 CGGGAAGAGGAGGGGCTCCCCGG + Intergenic
1153665455 18:7364162-7364184 CTGAAACAGCAGGGGGTCTGGGG + Intergenic
1157891564 18:51423111-51423133 CTGGCACAGCGGGGGCCTTCTGG + Intergenic
1158519173 18:58156559-58156581 AAGGAACATCAGGGGCTATCTGG + Intronic
1158881034 18:61779838-61779860 CTGGAAGTTCAGGGGCTCTGTGG - Intergenic
1160160117 18:76464618-76464640 CTGGACTTGCAGGGCCTCTCTGG + Intronic
1160160152 18:76464744-76464766 CTGGACTTGCAGGGCCTCTCTGG + Intronic
1160613267 18:80105632-80105654 TTAGAAAAGCAGGGGCCCTCTGG - Intergenic
1160696261 19:486059-486081 CGGGGACAGCAGGCTCTCTCTGG - Intergenic
1161555695 19:4941442-4941464 CTTGAACACCACGGGTTCTCGGG - Intronic
1163141855 19:15355099-15355121 CTGGAAGAGCAGGTGCCCTGTGG - Exonic
1163277748 19:16296128-16296150 CAGACACAGCAGGGGTTCTCTGG - Intergenic
1163290712 19:16377431-16377453 CCTCAACAGCAGGGGCCCTCTGG + Intronic
1164826398 19:31287783-31287805 CTGGTACAGAAGTGGCCCTCAGG + Intronic
1167257875 19:48442164-48442186 CTGGAGCGGCTGTGGCTCTCTGG + Exonic
1168675500 19:58275083-58275105 CTGGAAAAGGAGGGGATTTCAGG - Intronic
926967695 2:18433227-18433249 CTGGAACAGCAGATCCTCTAAGG - Intergenic
927525426 2:23735753-23735775 CTGGAACAAGAGGTGCTGTCAGG + Intergenic
932442474 2:71746494-71746516 CCTGAACAGCGAGGGCTCTCAGG + Intergenic
933760528 2:85668906-85668928 CTGCAGCTGCAGGGGCTCTCAGG + Intergenic
933862884 2:86487665-86487687 CTGAAACAGTAGGGGCTGTTGGG - Intronic
935702184 2:105822257-105822279 CAGGAGCAGCAGAGGCCCTCGGG - Intronic
936694365 2:114928912-114928934 CTGGAACAACAGGAGCTATCGGG + Intronic
939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG + Intergenic
943082716 2:183275875-183275897 CAGGATCAGTATGGGCTCTCCGG - Intergenic
945203273 2:207306271-207306293 GCAGAACAGCAGGGGCTCCCTGG - Intergenic
946537351 2:220646412-220646434 TGGAAACAGCAGGGGCTTTCTGG - Intergenic
946551948 2:220811372-220811394 CAGGAACAGAAGTGGCTGTCTGG + Intergenic
947671865 2:231942002-231942024 TTGGACCAGCAGCGGCTCTGCGG + Intergenic
947900700 2:233719048-233719070 ATGGAACAGCATAGGCTGTCAGG - Exonic
947988536 2:234468679-234468701 CTGGAGCAGCAGGAGCTCTGCGG - Intergenic
948369885 2:237482123-237482145 CTGGAAGAGCAGGGTCTCTTGGG - Intergenic
948384046 2:237570783-237570805 CTGGGATGGCAGGGGCTCCCAGG + Intergenic
1169966420 20:11222846-11222868 CTGGAGCTGCAGGGTCTTTCAGG + Intergenic
1170099268 20:12680846-12680868 CTGGAACAGATGGAGCTCTCTGG + Intergenic
1170454240 20:16517677-16517699 CAGGAACCCCAGGGGCACTCAGG + Intronic
1170789888 20:19498992-19499014 CTGGAACAGCTGGGGCTCCCTGG - Intronic
1171130831 20:22651811-22651833 CTGGAACACTGGGGGCTCCCTGG + Intergenic
1172052770 20:32131860-32131882 CTGGCACAGCATGGGGACTCAGG - Intronic
1172090681 20:32429944-32429966 CAGCAGCAGCAGCGGCTCTCTGG + Exonic
1172901966 20:38341853-38341875 CTGTAAAAGTAAGGGCTCTCTGG + Intergenic
1173884148 20:46441967-46441989 CTGGAAAAGGAGGGGATTTCAGG - Intergenic
1173921982 20:46753091-46753113 CGGGTGCAGCAGGGGCTCCCCGG - Intergenic
1174180066 20:48668967-48668989 CTAGGCCAGCAGGGACTCTCAGG + Intronic
1175586737 20:60147076-60147098 CTGGAGAGGCAGGGGCTCCCAGG + Intergenic
1175865702 20:62175251-62175273 ATGGAAGAGCGGGAGCTCTCGGG + Intronic
1175981143 20:62739309-62739331 CTGGAACAGCAGTGGGACCCAGG - Intronic
1176058652 20:63162106-63162128 CTCTATCAGCACGGGCTCTCTGG - Intergenic
1176288736 21:5033339-5033361 CAGGAACACCAGGGGCTTTAGGG + Intronic
1177117777 21:17106017-17106039 CTGGAAGAGAAGGGGCCCTCTGG - Intergenic
1178699742 21:34823004-34823026 CTGGCACAGCATAAGCTCTCTGG + Intronic
1179648175 21:42788443-42788465 CTGGATCAGCAGCAGGTCTCCGG - Intergenic
1179868448 21:44230136-44230158 CAGGAACACCAGGGGCTTTAGGG - Intronic
1179902130 21:44399791-44399813 CTGGAGCAGCAGGGGCTCCCAGG + Intronic
1180116915 21:45713701-45713723 CTGGAATGGCAGGTGCTCTAAGG - Intronic
1180605630 22:17057025-17057047 CTGGATGTGCAGGGGCTCCCTGG - Intergenic
1180955160 22:19738212-19738234 CTGGAGGAGGAGGGGCACTCGGG - Intergenic
1181273316 22:21673427-21673449 CTGGGACAGCAGGGGCCATGAGG - Intronic
1181682502 22:24505585-24505607 ATGGTTCAGCAGAGGCTCTCTGG - Intronic
1183417447 22:37690770-37690792 CTGAGAGAGCAGGGGGTCTCTGG - Exonic
1183485482 22:38085833-38085855 CTGGCATGGCAGGGGCTCTCTGG - Intronic
1183694787 22:39415583-39415605 CTGGCCCAGCAGGAGCTCTGCGG - Exonic
1183712756 22:39515351-39515373 CTAGAAAAGCAGGGCCTGTCTGG - Exonic
1183812956 22:40273519-40273541 CTGGAACACCACTGGCTCTCAGG + Exonic
1184430631 22:44439915-44439937 CTGGATCTGCAGGGGCTCAGAGG + Intergenic
1184448922 22:44571305-44571327 CCGGCACATCATGGGCTCTCTGG - Intergenic
1184765265 22:46569037-46569059 GAGGGACAGCAGGGGCTCCCCGG + Intergenic
1185153489 22:49179701-49179723 CTGGAACCACAGAGGCTCCCAGG - Intergenic
1185184034 22:49381903-49381925 CCAGTACAGCAGGGGCTTTCAGG - Intergenic
1185326623 22:50228775-50228797 CTGCTGCAGCAGGGGCTGTCGGG - Intronic
949441222 3:4082820-4082842 ATGGAAAAGGAGGGTCTCTCAGG + Intronic
950544602 3:13630879-13630901 ATGGCCCAGCAGGGACTCTCGGG - Intronic
950933375 3:16813271-16813293 CTGGAACAGTTGGGGCTAGCTGG + Intronic
951245097 3:20331588-20331610 CTGGAAAAGCTGGAGATCTCTGG + Intergenic
952175945 3:30863236-30863258 CTGAAAAATTAGGGGCTCTCAGG - Intronic
954807748 3:53230207-53230229 ATGGGACTGCAGGTGCTCTCAGG - Intronic
954959520 3:54551685-54551707 CTGGAACAGCGTGGGTGCTCTGG + Intronic
956919689 3:73913883-73913905 CTGGAAAAGGAGGGGATTTCAGG + Intergenic
957538602 3:81538879-81538901 CTGGGACAGCCGTGGATCTCTGG + Intronic
959838642 3:110949371-110949393 CTGTAACAGCAGGGGGGCCCTGG + Intergenic
960613400 3:119575304-119575326 CTAGAAGAGCAGGGGCTGTCAGG + Intergenic
960949132 3:122987629-122987651 CTGGGGCAGCAGAGGTTCTCAGG + Intronic
961511348 3:127405747-127405769 CTGGAAAAGGAGGGGATCTCAGG - Intergenic
962846494 3:139278633-139278655 CTGCCACAGCAGGAGCTTTCTGG - Intronic
964212786 3:154246633-154246655 CAGGAACAACAGGGGCCCTGGGG + Intronic
968846707 4:3046965-3046987 CTGGAACAGCTTGTGCCCTCGGG - Intergenic
969309641 4:6345985-6346007 CTGGAACAACAGGGGGTGCCAGG - Intronic
969559087 4:7934558-7934580 CTGGGATATCAGGGGCACTCAGG + Intronic
973602605 4:52557069-52557091 ATGGAACAGCTGGGGCTCCTTGG - Intergenic
980419602 4:132542592-132542614 CTTGAGCTGAAGGGGCTCTCTGG + Intergenic
981748409 4:148072089-148072111 CAGGGTCAGCAGGGGCTCTGAGG - Exonic
982615349 4:157633998-157634020 CTGGAGCAGCAGTGGCTATGAGG + Intergenic
983554143 4:169045017-169045039 CTGGAACAGCTGGGGCCCCTTGG + Intergenic
986054123 5:4119132-4119154 CTGGCACATCATGGGCACTCAGG - Intergenic
986237480 5:5925723-5925745 TGAGGACAGCAGGGGCTCTCAGG + Intergenic
992734262 5:79703106-79703128 CTGGACCAGCAGGGGGCCCCGGG + Intronic
996775802 5:127131121-127131143 CTGCAACACCCTGGGCTCTCCGG - Intergenic
997143203 5:131405459-131405481 CTGGAACAGAAAGAGCTCTTTGG - Intergenic
997659668 5:135579486-135579508 CTGGCCCAGCAGGGGCCCTTGGG - Intergenic
997830241 5:137143445-137143467 CTGGAACAGCACGGACTCCAAGG + Intronic
998737794 5:145162625-145162647 CTGGAATAGCTGGGGCTGTCTGG + Intergenic
1000341553 5:160280782-160280804 CTGGGACAGCCGAGACTCTCAGG - Intronic
1001398506 5:171433220-171433242 CAGGGTCAGCAGGGGCTATCGGG - Intronic
1001789633 5:174444897-174444919 CTGGAAGAGCAGTGGCTCCTGGG + Intergenic
1002299438 5:178248999-178249021 CTGAGACCGCAGGGGCTGTCAGG + Intronic
1002431609 5:179207429-179207451 CTGGCCCAGCTGGGCCTCTCTGG + Intronic
1002465489 5:179406241-179406263 CTGGTAAAGCTGGGGCCCTCAGG + Intergenic
1002690709 5:181048076-181048098 CAGGAGCAGCAGGAGCTCCCTGG + Exonic
1002706425 5:181163707-181163729 GTTGAACAGCAGGGGCGCGCTGG - Intergenic
1002707602 5:181173265-181173287 GTTGAACAGCAGGGGCGCGCTGG - Intergenic
1006176330 6:32124257-32124279 CTGCAAAAGCAGGGGCTTTCTGG - Intronic
1007309499 6:40934257-40934279 ATGGAGAAGCAGAGGCTCTCTGG - Intergenic
1007719650 6:43877504-43877526 CTGGACTAGCCTGGGCTCTCTGG + Intergenic
1011189525 6:84715174-84715196 CTGAAACAGAAGTGGCTTTCAGG - Intronic
1012063190 6:94512626-94512648 CTGGAGGAGAAGGGGCACTCTGG - Intergenic
1012093574 6:94931156-94931178 TTGGAAGAGAAGGGGCACTCTGG + Intergenic
1013915015 6:115326486-115326508 CTGAAATACCAGGGGTTCTCAGG + Intergenic
1015818147 6:137231258-137231280 CTGCAACATCAGCTGCTCTCTGG - Intergenic
1017036925 6:150275278-150275300 CTCGAAGACCAGGGGATCTCAGG + Intergenic
1017551734 6:155516970-155516992 CTGGAAAAGGAGGGGATTTCAGG - Intergenic
1017963810 6:159246509-159246531 ATGCCACAGCAGGCGCTCTCAGG - Intronic
1019140148 6:169937731-169937753 CTGGAGCAGCAGGGACTCTGGGG + Intergenic
1019177595 6:170168094-170168116 CTGGAACAGGAGTGGCTGCCAGG + Intergenic
1019326196 7:439488-439510 CTGAGCCACCAGGGGCTCTCGGG - Intergenic
1019538116 7:1539286-1539308 CTGGGATAGCAGGGGCTGTCGGG - Intronic
1019918609 7:4149277-4149299 CTGGGGCACCAGGAGCTCTCTGG - Exonic
1020212821 7:6168562-6168584 CTAGAGCAGCAGGTGCTCACCGG + Intronic
1021089233 7:16462781-16462803 CTGGAGCAGGAGGAGCTCCCAGG - Exonic
1021262857 7:18480472-18480494 CTGGCACAGCAGTTGCTCTATGG - Intronic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1023866530 7:44241069-44241091 CAGGAAAAGAAGGGGCTGTCAGG - Intronic
1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG + Intergenic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1026534627 7:71229633-71229655 CTGGGACATCAGGGGCTGTTTGG - Intronic
1030727167 7:112939638-112939660 CTGGAGCAGGAGAAGCTCTCCGG - Exonic
1033719088 7:144037881-144037903 CTGAGACAGCAGGAGCTCCCGGG + Intergenic
1034405522 7:150900134-150900156 GGGGCACAGCAGAGGCTCTCTGG - Intergenic
1035054051 7:156022156-156022178 CTGGCAAGGCAGGGGTTCTCTGG + Intergenic
1035542190 8:449294-449316 CTGGAAAAGCAGGGCATCCCTGG + Intronic
1037522410 8:19692874-19692896 CTGGCACAGGAAGGGCTCTCAGG + Intronic
1037669135 8:20999232-20999254 CTGGTTTGGCAGGGGCTCTCAGG + Intergenic
1039457560 8:37717607-37717629 CTGGCCCAGCAGGGGCTCTCTGG + Intergenic
1040088341 8:43368352-43368374 TTGGAAGATCAGGGACTCTCTGG - Intergenic
1040780747 8:51106689-51106711 GTGGTACACCAGGGGCTCTATGG - Intergenic
1041256616 8:55984319-55984341 CTGAGCCAGCAGGGGCTCACGGG - Intronic
1041366744 8:57114382-57114404 GAGGAACAGCAGCGGCTCTCTGG - Intergenic
1042482760 8:69322722-69322744 CTAGAACAGCAGCTCCTCTCCGG - Intergenic
1043884338 8:85581213-85581235 CTGGAAGAGAAGAGGCACTCTGG - Intergenic
1045106907 8:98901562-98901584 CAGGAGCAGCAGGGGTTCCCAGG + Intronic
1045241910 8:100410107-100410129 CTGGAGCAGCTGGAGCTCTTTGG + Intergenic
1045254256 8:100506405-100506427 CAGGTAGAGCAGAGGCTCTCAGG - Intergenic
1046903952 8:119552808-119552830 CGGGAACAGGAGGGACTTTCAGG + Intergenic
1047446530 8:124925153-124925175 CTGGAACACCAAGGGCTGGCAGG - Intergenic
1048982507 8:139710416-139710438 TTGGAACAGCAGGGTATCCCTGG - Intergenic
1049093697 8:140535314-140535336 CTGGCACAGCCTGGGCTCCCCGG + Intronic
1049148327 8:141018315-141018337 CAGGAAAAGCAGCAGCTCTCTGG + Intergenic
1049583738 8:143423708-143423730 CTGGGACAGCGGGGGCACTCAGG + Intronic
1053055891 9:34992875-34992897 CTCGCTCAGCAGGGCCTCTCAGG + Intronic
1055828972 9:80358456-80358478 CATGCACAGCAGGGGCTCCCTGG - Intergenic
1056617147 9:88178485-88178507 CTGGAAAAGGAGGGGATTTCAGG + Intergenic
1056663143 9:88559298-88559320 CAGGAATAGCAGCAGCTCTCTGG + Intronic
1056936664 9:90919911-90919933 CTGGAACAGCACGGGCTGAGTGG - Intergenic
1057254742 9:93536356-93536378 CTGGAGCAGCAGGCTCTCACTGG - Intronic
1057396991 9:94689340-94689362 CTGGAACAGCAGGTGCTGAGGGG - Intergenic
1057786546 9:98092368-98092390 CGGGCACAGCAGGGGCACCCAGG + Intronic
1059299671 9:113302285-113302307 CTGAAACAGCAGTGGATCCCTGG - Intronic
1060228299 9:121809424-121809446 CTGGCGCAGAAGGGGCCCTCAGG - Intergenic
1060247531 9:121958886-121958908 CTGGAGAAGCAGGTGCTCTAGGG + Intronic
1061355803 9:130104023-130104045 CTGGGACAGCCGGGGCTCCTGGG + Intronic
1061396164 9:130344196-130344218 CGGGAAGTACAGGGGCTCTCAGG + Intronic
1062038857 9:134395097-134395119 CTGGGACACCGTGGGCTCTCAGG + Intronic
1186517963 X:10180882-10180904 CTAGAACAGCTGGGGTTCCCAGG - Intronic
1187082598 X:16006886-16006908 CTGGAACAGATGGGGCTTCCTGG + Intergenic
1187154864 X:16712881-16712903 CAGGAACTGCAGGAGCGCTCAGG + Intronic
1187726034 X:22203144-22203166 CTGGGACAGAAGGGGCTCCTGGG - Intronic
1189438093 X:41010427-41010449 CGGGAGCTGCAGGGCCTCTCAGG - Intergenic
1193731640 X:85109532-85109554 CTAAAACAGCAGGGACTCTTGGG - Intergenic
1195038324 X:100990523-100990545 CAGGAACAACAGGGGTTCTCAGG - Intronic
1197076989 X:122364426-122364448 CTGGAAAAGCAGGGGCAATTAGG - Intergenic
1197724677 X:129768567-129768589 ATGGGCCAGCAGGGGCTCTTGGG - Exonic
1198499294 X:137226776-137226798 CTGGAACAACAGACTCTCTCTGG - Intergenic
1200124886 X:153808512-153808534 CTGGATCACCAGGGGCTCCTTGG + Exonic
1200249171 X:154543079-154543101 CTGGAACAGCTCCGGCTCCCAGG - Intronic