ID: 1098270180

View in Genome Browser
Species Human (GRCh38)
Location 12:68762388-68762410
Sequence CAGAGGAAGGAGGAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3314
Summary {0: 1, 1: 3, 2: 42, 3: 396, 4: 2872}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098270180 Original CRISPR CAGAGGAAGGAGGAGGAGGC GGG Intronic
Too many off-targets to display for this crispr