ID: 1098270201

View in Genome Browser
Species Human (GRCh38)
Location 12:68762510-68762532
Sequence CATTCTGCCTGGAGTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098270192_1098270201 23 Left 1098270192 12:68762464-68762486 CCATTGAGGGACTGAGTGAGGTG 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG 0: 1
1: 0
2: 3
3: 23
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098270201 Original CRISPR CATTCTGCCTGGAGTAAAGT GGG Intronic
900721059 1:4176070-4176092 CAGGCTGCCTGGGGTAGAGTTGG - Intergenic
902171986 1:14619156-14619178 CATTGTGCATGGAGTAAAACTGG - Intronic
902663741 1:17923181-17923203 CATTGTGCCTGGCATATAGTAGG - Intergenic
903187132 1:21635050-21635072 CATTCTGCCTGGAAGAAAACTGG + Intronic
904387857 1:30157231-30157253 CATTCTATCAAGAGTAAAGTGGG - Intergenic
904929406 1:34074414-34074436 CATTTTGGCTGGTGTATAGTGGG - Intronic
906413090 1:45595031-45595053 CACTCAGGCTGGAGTACAGTGGG + Intronic
907812823 1:57889160-57889182 CATAGTGCCTGTCGTAAAGTAGG + Intronic
907813931 1:57899978-57900000 CACTCAGGCTGGAGTACAGTGGG + Intronic
908139629 1:61170685-61170707 CATTCTTCGTGGTGTATAGTAGG + Intronic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
908476680 1:64495555-64495577 CTGTCTGCCTGGATTGAAGTTGG + Intronic
909175079 1:72347111-72347133 CTTTCTGCATGGAGTAAGATGGG - Intergenic
909493625 1:76253254-76253276 CATTCTTCCTTCAGTAAATTAGG + Intronic
909639353 1:77854590-77854612 CATTCTTGCAGGAGTAAAGTAGG + Intronic
910146751 1:84088763-84088785 CATAGTGCCTGGTTTAAAGTAGG - Intronic
910744466 1:90558362-90558384 CCTTCTGCCTGGATTTTAGTTGG + Intergenic
913045778 1:115072525-115072547 TATTGCCCCTGGAGTAAAGTGGG - Intronic
914454934 1:147827196-147827218 CATTCTTGCAGGAGTAAGGTGGG + Intergenic
916479705 1:165203897-165203919 AATTCTGCATGGAGTACAGATGG + Exonic
917267642 1:173238704-173238726 CATTCTGACTGGTGTAACATGGG - Intergenic
918118934 1:181520956-181520978 CATTCTTCCTGGAGGAGAGAGGG - Intronic
919087278 1:192935432-192935454 CATTTTGCCTGGTGGAATGTTGG + Intergenic
919344793 1:196361636-196361658 CTTTCTGACTGCAGCAAAGTGGG - Intronic
919662249 1:200258685-200258707 CCTTCTGCCTGCAGTGAAGGTGG - Intergenic
920442729 1:205992023-205992045 ATTTCTGCCTGGGGTCAAGTTGG - Intronic
920613308 1:207464092-207464114 CTTTTTGCATGGAATAAAGTTGG - Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
921734046 1:218606609-218606631 CACTCAGGCTGGAGTACAGTGGG + Intergenic
923809063 1:237292439-237292461 CATTCTGCCTGTTCTGAAGTAGG - Intronic
924369861 1:243336312-243336334 CATTCTGACTGGTGTGAAATGGG + Intronic
924407060 1:243758981-243759003 CATTCTGACTTAAGTTAAGTAGG + Intronic
1063796615 10:9519869-9519891 CATCCAGGCTGGAGTAAAGATGG + Intergenic
1064203666 10:13304786-13304808 CACTCAGGCTGGAGTACAGTAGG - Intergenic
1064553518 10:16525266-16525288 GAGTCTGCCTGGAGTTATGTAGG + Intergenic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1067154631 10:43767584-43767606 CATTCTGGCTGGGGTGAAGTGGG + Intergenic
1068101871 10:52565052-52565074 CATTCTGGCTGGAGAAATTTAGG - Intergenic
1069757290 10:70781093-70781115 TGGTCTGGCTGGAGTAAAGTAGG - Intronic
1069838942 10:71327257-71327279 CCTTCTGCCTGGACAAATGTGGG + Intronic
1070645842 10:78201940-78201962 CTTTCTGTCTGGGGTAAAGTGGG + Intergenic
1071800112 10:89050355-89050377 CCTTGTGCCTTGAATAAAGTAGG + Intergenic
1074506721 10:114077514-114077536 CATTCTGCCTGAAGTAATCAAGG + Intergenic
1074660962 10:115657034-115657056 CAATTAGCCTGCAGTAAAGTTGG + Intronic
1074686022 10:115963183-115963205 CATTCTTCCTGGAGAAAAGAGGG + Intergenic
1075194086 10:120339793-120339815 TGTTCTGCCTGGAGTAGAGGTGG - Intergenic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077876323 11:6310526-6310548 CATTCTCACAGGAGTAAGGTGGG + Intergenic
1079934729 11:26602708-26602730 CATTCAGGCTGGAGTACAGTGGG - Intronic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1083244958 11:61419735-61419757 CATTGTGCTGGGAGTCAAGTAGG - Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085533841 11:77206573-77206595 GGTTCTGCCTGCAGGAAAGTGGG - Intronic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1086773407 11:90798031-90798053 TAATCTGCCTGGAGTCAATTTGG - Intergenic
1087069527 11:94063790-94063812 CATTCTGTGTGGAGCAAAGGAGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088241169 11:107775150-107775172 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092652777 12:10652653-10652675 GATACGGCCTTGAGTAAAGTTGG - Intronic
1093058730 12:14580744-14580766 CATACTGCCTGGAATATAGTAGG - Intergenic
1093612299 12:21176214-21176236 CATAATGCCTGGAATACAGTAGG + Intronic
1095164113 12:38951339-38951361 CACCCTGCCTGGACAAAAGTTGG + Intergenic
1096884577 12:54704040-54704062 TAATCTACCTGGATTAAAGTAGG + Intergenic
1097316608 12:58178031-58178053 CCTTCTGCCTGGAGCAATGTGGG - Intergenic
1097933503 12:65217856-65217878 CACTCAGGCTGGAGTGAAGTAGG + Intronic
1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG + Intronic
1098296874 12:69012861-69012883 CATGCTGGCTGAAGTAAACTGGG + Intergenic
1098609754 12:72441902-72441924 CATTTTTCCTTGAGTAAACTTGG + Intronic
1100049123 12:90423821-90423843 CAGTCTGCCTGGAGTCATGAAGG - Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101756915 12:107628179-107628201 CACTCAGGCTGGAGTACAGTGGG + Intronic
1102094150 12:110222087-110222109 CCTTCTGTATGGAGTAAAGATGG - Intergenic
1102404059 12:112657130-112657152 CATTCTGACTGGTGTAAGATGGG + Intronic
1102869427 12:116402070-116402092 CATTCAGCCTGGAGTGGGGTGGG + Intergenic
1104039846 12:125122600-125122622 CACTCAGGCTGGAGTACAGTGGG - Intronic
1104754817 12:131262380-131262402 CCCTCTGCTTGGCGTAAAGTAGG + Intergenic
1105457315 13:20553583-20553605 GCTTGTGCCTGGAGCAAAGTGGG - Intergenic
1106644353 13:31616599-31616621 CAGGCAGGCTGGAGTAAAGTGGG - Intergenic
1108687013 13:52828429-52828451 CATTCTGCCTTGCACAAAGTAGG + Intergenic
1109597912 13:64580508-64580530 CATTCAGGCTGGAGTGCAGTGGG - Intergenic
1109864687 13:68247259-68247281 CATTCTGACTGGTGTGAAGTGGG + Intergenic
1111734777 13:92124226-92124248 CATTCTGTCCGGAGTTAAGATGG - Intronic
1112234644 13:97624480-97624502 CCTTCTTCCTGGAGGAAAATGGG + Intergenic
1113937853 13:114004517-114004539 CGTTCTGCCTGGCGTGAGGTGGG - Intronic
1113937861 13:114004554-114004576 CATTCTGCCTGGCGTGAGCTGGG - Intronic
1115606033 14:35003127-35003149 CATACTTCCTGAAATAAAGTAGG - Intronic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1122299201 14:100722526-100722548 CATGGAGCCTGGAGGAAAGTGGG - Intergenic
1124698038 15:31882893-31882915 CATTCTTCCTGGAGTAGACATGG - Intergenic
1124785556 15:32676406-32676428 CATTCTGCCTTGAGCCAAGTTGG + Intronic
1125640093 15:41223377-41223399 CATTCAGCCTGGAGTGCAGTGGG - Intronic
1125739960 15:41955556-41955578 TACTCTCCCTGGAGTAAAGCTGG + Intronic
1125981276 15:44003541-44003563 TATTGTGTTTGGAGTAAAGTAGG - Intronic
1126360285 15:47838466-47838488 CGTTTTGCCTGAAGTAGAGTTGG + Intergenic
1126486328 15:49185657-49185679 CATTCTGACTAGTGTAAGGTGGG + Intronic
1127044540 15:55011795-55011817 CAATGGACCTGGAGTAAAGTGGG + Intergenic
1127164924 15:56234628-56234650 CATCTTGCTTAGAGTAAAGTTGG - Intronic
1127515257 15:59687730-59687752 CATTCTATCTGGAGTAATGCTGG - Intronic
1127911989 15:63424155-63424177 CACTGTGCCTGGCCTAAAGTGGG + Intergenic
1129579723 15:76794955-76794977 AATTCTGCCTAGACTAAATTAGG + Intronic
1129711618 15:77823139-77823161 CACTCTGCCAAGAGTAAAGAGGG - Intergenic
1130549265 15:84879463-84879485 CATTCTGCCTGCCTTAAAGTGGG - Intergenic
1130919939 15:88335473-88335495 CATTCTGCCTGGGGAAGAGAAGG + Intergenic
1131760124 15:95613331-95613353 CACACTACCTGGAATAAAGTAGG - Intergenic
1132191380 15:99865137-99865159 CATACTGACTTGTGTAAAGTGGG + Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1136038916 16:27562500-27562522 CAATCTGCCTTGAGAAACGTTGG - Intronic
1137947448 16:52747552-52747574 CACTCTGCCTAGACCAAAGTAGG + Intergenic
1138076682 16:54049707-54049729 CATTCTGCCTGAAGGGAAGGAGG - Intronic
1138158681 16:54731696-54731718 CATTCTTCCTAGACTAAAGATGG + Intergenic
1138690389 16:58762324-58762346 CATCCAGGCTGGAGTACAGTAGG - Intergenic
1140705292 16:77623190-77623212 CATTCTGGCTGGGGTAAAGTTGG + Intergenic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1144125027 17:12195237-12195259 CATTTTACCTTGAATAAAGTTGG - Intergenic
1144279219 17:13707993-13708015 GATTGAGCCAGGAGTAAAGTAGG + Intergenic
1148431466 17:47647239-47647261 CATCCAGGCTGGAGTACAGTGGG + Intergenic
1149344392 17:55719567-55719589 CATTATGCCTGGCATATAGTTGG + Intergenic
1149909691 17:60555768-60555790 CACTCAGGCTGGAGTACAGTGGG + Intergenic
1149945426 17:60920542-60920564 CATTCTGACTGGTGTTAAGGTGG - Intronic
1150193061 17:63263779-63263801 CATTATGCCTGGCATAAAATAGG - Intronic
1150673991 17:67228619-67228641 CATCCTGGCTGGAGTTCAGTGGG - Intronic
1152439869 17:80300236-80300258 CATTCTGACTGGTGTTAAGATGG + Intronic
1155123504 18:22846916-22846938 TATTCTGCCTGGTATATAGTAGG - Intronic
1157411732 18:47468862-47468884 CAATTTGGCTGGAGAAAAGTGGG - Intergenic
1161421145 19:4176546-4176568 CATCCAGGCTGGAGTACAGTGGG - Intronic
1161494208 19:4578880-4578902 GATTCTGCCTGGAGGAGAGGGGG - Intergenic
1162881045 19:13659681-13659703 CAATCTTCCTGGAGAAAAATTGG - Intergenic
1163818251 19:19481115-19481137 TTTTCTCCCTGGAGGAAAGTGGG + Intronic
1167617799 19:50545538-50545560 CATTCAGGCTGGAGTGCAGTGGG - Intronic
1167632875 19:50636750-50636772 CATGCTGCCTGGACCACAGTTGG + Intronic
1167993646 19:53384014-53384036 TATTCTGCAAGGAGTGAAGTCGG - Exonic
1168369158 19:55817135-55817157 CATTCTTGCAGGAGTAAGGTGGG - Intronic
1168522266 19:57061743-57061765 CATCCTGGCTGGAGTGCAGTGGG - Intergenic
927700584 2:25265888-25265910 CATAGTGCCTGATGTAAAGTAGG + Intronic
932045023 2:68339652-68339674 CTATCTACCTGGAGTAGAGTCGG - Intergenic
932985272 2:76719001-76719023 CATGTTTCCTGGAGTAGAGTAGG + Intergenic
933906868 2:86902947-86902969 CATCCAGGCTGGAGTACAGTGGG + Intergenic
934024609 2:87990705-87990727 CATCTAGACTGGAGTAAAGTGGG - Intergenic
934580532 2:95434323-95434345 CATTCTGAGTGGAGCAAACTTGG - Intergenic
934598917 2:95642394-95642416 CATTCTGAGTGGAGCAAACTTGG + Intergenic
935001133 2:99016953-99016975 CATTCTTGCAGGAGTAAGGTAGG - Intronic
935030237 2:99314757-99314779 CATCCTGGCTGGTGCAAAGTGGG + Intronic
935159864 2:100520896-100520918 TATTCTGAAAGGAGTAAAGTAGG + Intergenic
936532263 2:113284388-113284410 CATTCTGAGTGCAGTAAACTTGG + Intergenic
938933652 2:136109588-136109610 CACTGTGCCTGGCGTATAGTAGG - Intergenic
939901614 2:147857643-147857665 CATTCTGCCAGGAGAAAACCTGG + Intronic
940025167 2:149199013-149199035 CATACTGGCTGGAGTAAATCTGG - Intronic
940052957 2:149483136-149483158 CATCCTGCCTGGAGGCCAGTGGG - Intergenic
940106538 2:150107308-150107330 CATTGTGCCTTGGGTAAAGAAGG - Intergenic
943488888 2:188524109-188524131 CATTCTGATTGTAGTGAAGTTGG - Intronic
943564951 2:189506252-189506274 CCTTCTACTTGGGGTAAAGTTGG + Intergenic
944702500 2:202258626-202258648 CACTCAGCCTGGAGTGCAGTGGG + Intergenic
947048920 2:226020161-226020183 CATTTTGCCTAGTGTAAATTAGG + Intergenic
947511155 2:230755328-230755350 CATTCTTGCAGGAGTAAGGTGGG + Intronic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
1169014875 20:2283495-2283517 CACCCAGGCTGGAGTAAAGTGGG + Intergenic
1170442667 20:16395147-16395169 CTTTCTGCCTTGACTAAACTGGG - Intronic
1170555622 20:17512677-17512699 CACTCAGGCTGGAGTACAGTGGG - Intronic
1171024537 20:21616950-21616972 CATGCTGCCTGGAGGGAAGTCGG - Intergenic
1172142849 20:32735691-32735713 CTTTCAGGCTGGAGTACAGTGGG + Intronic
1173333203 20:42092787-42092809 CATTCTCCCAGGAGAAAAGCAGG - Intronic
1173395804 20:42678339-42678361 CATTCAGGCTGGAGTGCAGTGGG + Intronic
1173654544 20:44690595-44690617 CATCCAGGCTGGAGTACAGTGGG - Intergenic
1174672605 20:52322084-52322106 AATTCTGACTGGAGGAAAGCTGG + Intergenic
1175304882 20:57969119-57969141 CCATGTGCCTGGAATAAAGTGGG + Intergenic
1178112710 21:29385091-29385113 CATTGTGCCAGGAGGAAAGAAGG - Intronic
1179004022 21:37493979-37494001 CACTCAGGCTGGAGTATAGTGGG + Intronic
1179174560 21:38998521-38998543 CATTCTGACTGGTGTGAAATGGG + Intergenic
1179668116 21:42926358-42926380 CATTGTGCCTGGCCTCAAGTGGG + Intergenic
1183075957 22:35426839-35426861 CATGCAGCCAGGAGTAGAGTGGG - Intergenic
949410185 3:3755045-3755067 CATTTTGCCTGGACTAGAGTTGG + Intronic
949722980 3:7012223-7012245 CATGCTGCCTTGAGTGAACTAGG - Intronic
950012812 3:9735061-9735083 CACCCTGCCTGGAGTGCAGTTGG + Intronic
950236983 3:11331087-11331109 CATTGTGCCTGGCAGAAAGTAGG - Intronic
950271091 3:11615849-11615871 TACTCTGCCTGGAATAAAGCAGG + Intronic
952981036 3:38736182-38736204 CTTTTTGGCTGGAGCAAAGTGGG + Intronic
954539333 3:51383287-51383309 CACTCTGCCTGGAGTGAACCTGG - Exonic
955168481 3:56539395-56539417 CATTCAGTCTTCAGTAAAGTTGG - Intergenic
955743337 3:62115676-62115698 CATCCAGGCTGGAGTACAGTGGG + Intronic
956516691 3:70057164-70057186 CATTCTGACTTGACTAAAATTGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
959028024 3:101264591-101264613 CATACTGCATGGGGAAAAGTTGG + Intronic
959567870 3:107851158-107851180 CATTCTTGCCGGAGTAAAGGTGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961686521 3:128636418-128636440 CATTCAGACTGGAGTGCAGTGGG - Intronic
961723647 3:128911838-128911860 CATTTTGGATGGAGTACAGTGGG - Intronic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
965367143 3:167814849-167814871 CATGCTGCCTGGAGGAAAGTAGG + Intronic
965514147 3:169602628-169602650 TTTTCTCCCTGGGGTAAAGTTGG - Intronic
966558481 3:181291362-181291384 AATTCTTCTTGGAGTAGAGTGGG + Intergenic
968072861 3:195798075-195798097 CATGCAGGCTGGAGTACAGTGGG - Intronic
969617388 4:8261787-8261809 CATGCGGCCTGGACTAAAGCTGG - Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970445331 4:16119194-16119216 CACCCAGGCTGGAGTAAAGTGGG - Intergenic
971479076 4:27098594-27098616 GATTCTGCCTGGAATAAACCTGG - Intergenic
971822525 4:31576597-31576619 CATTCTGACTGGTGTTAAGATGG + Intergenic
971989715 4:33876428-33876450 CATTCTGACTGGTGTGAAATGGG + Intergenic
973366356 4:49212646-49212668 TACTCTGCCTTGAGAAAAGTTGG - Intergenic
975681256 4:76878821-76878843 CATTGTGCCTAGAATAAAGCAGG + Intergenic
975768546 4:77695951-77695973 CATTCTGTCTGGAGTAGGGAAGG - Intergenic
975775856 4:77786512-77786534 CACTCAGGCTGGAGTACAGTGGG + Intronic
977813946 4:101391730-101391752 CACTCTGGCTGGGGTAAGGTGGG - Intergenic
978048671 4:104167489-104167511 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
978433547 4:108658870-108658892 CATCCTGCCAGGACTAAAATGGG - Intronic
980073925 4:128273425-128273447 CACTGTGCCTGGCATAAAGTAGG + Intronic
980238581 4:130141793-130141815 TATTCTGCCTAGAGAAAAGTCGG + Intergenic
984294612 4:177838678-177838700 ATTTCTGCATGCAGTAAAGTTGG - Intronic
985030285 4:185782040-185782062 CATTCTGCCTGGCCCTAAGTAGG + Intronic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
986397582 5:7345445-7345467 GATTTTGCTTTGAGTAAAGTTGG + Intergenic
987374350 5:17219144-17219166 CATTTTGCCTGCAGTATACTGGG - Intronic
987416249 5:17664452-17664474 CATTCTCGCTGGGGTAAGGTGGG + Intergenic
988558991 5:32263344-32263366 CATTCTGCTTGGATAAAAATGGG - Intronic
988845346 5:35121987-35122009 CATTCTGGGTGGAATAAAGTGGG + Intronic
989130876 5:38105606-38105628 CATACTGCCTGGCCAAAAGTAGG + Intergenic
991266421 5:64724653-64724675 AATTCTTCTTGGAGTAAGGTAGG + Intronic
992273577 5:75091256-75091278 AATTATGCTTGGAGTAAGGTGGG - Exonic
992979028 5:82147783-82147805 CTTTCTGACTGGAGGAAACTGGG - Intronic
994827284 5:104730544-104730566 CAGTCTGCCTGGTGAAAAGTGGG + Intergenic
996899195 5:128524123-128524145 CCATGTCCCTGGAGTAAAGTGGG - Intronic
997806753 5:136925524-136925546 CATACTGCCTGAACCAAAGTAGG - Intergenic
998052052 5:139043945-139043967 CTTCCTGCCTGGAGTAGAGCAGG - Intronic
998665652 5:144294116-144294138 CATTCAGGCTGGAGTGTAGTGGG - Intronic
998963727 5:147514640-147514662 CATTCTGCCTGGCATACAGTAGG + Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000188802 5:158888043-158888065 CAGTCTGCTTGGAGTAAAGCTGG + Intronic
1001698798 5:173691811-173691833 CACCCAGGCTGGAGTAAAGTGGG - Intergenic
1003188382 6:3851896-3851918 CACCCAGCCTGGAGTGAAGTGGG - Intergenic
1003894208 6:10591463-10591485 CATTTTATCTGGAATAAAGTGGG - Intronic
1005770857 6:29069617-29069639 CATTCTTGCAGGAGTAAGGTTGG - Intronic
1012528470 6:100205576-100205598 CATTCTGCTTGGAGGAGAGAAGG + Intergenic
1012832858 6:104227702-104227724 CTTTCTGCTGGGAGTGAAGTGGG - Intergenic
1015609769 6:135004156-135004178 CATAGTGCCTGGTGTATAGTAGG - Intronic
1016892046 6:149016519-149016541 CACCCTGCCTGGACTAAAGCAGG - Intronic
1016918824 6:149271165-149271187 CACTCAGGCTGGAGTACAGTGGG - Intronic
1017769868 6:157636655-157636677 CATTCCCCCTGGAGAAAAGTGGG + Intronic
1017798142 6:157866235-157866257 TATTCTGGCTGGAGTAAGGAGGG - Intronic
1020166979 7:5814957-5814979 CACCCAGGCTGGAGTAAAGTGGG - Intergenic
1022414308 7:30164996-30165018 CATTTTGCTTGGAGCAAGGTGGG + Intergenic
1025851574 7:65248947-65248969 CATTCAGGCTGGAGTGCAGTAGG + Intergenic
1026404123 7:70047307-70047329 CATTCTGCCTGGAATACTATAGG - Intronic
1028029852 7:85896840-85896862 TATTCTGTCAGGAGTAAATTGGG - Intergenic
1028239833 7:88406195-88406217 CATTTTGCCTGCAGGAAAGATGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1030425685 7:109374286-109374308 CATTCTTGCAGGAGTAAGGTGGG + Intergenic
1030681353 7:112437703-112437725 CATTCTGCAGGGATGAAAGTGGG + Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037771293 8:21801639-21801661 CACTCTGCCTGGAGCACAATAGG - Intronic
1038470127 8:27808642-27808664 CACTCAGGCTGGAGTACAGTGGG - Intronic
1040866961 8:52057325-52057347 CATTCTTCCTGGTGGAATGTTGG + Intergenic
1041758745 8:61341237-61341259 CATTCTGTCTGGAGGGAACTGGG + Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042503095 8:69530932-69530954 CATTCTGTCTGGAGTACAGTAGG - Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043888462 8:85630185-85630207 CATCCTACCTGGTGAAAAGTGGG + Intergenic
1044415338 8:91932623-91932645 CATTCTGGCAGAAGTAAAGGTGG - Intergenic
1044486754 8:92763489-92763511 AATTCTTCCTGGTGTAAACTTGG - Intergenic
1045072272 8:98520565-98520587 CCTTCTGCCTTGAGGAAAATGGG - Intronic
1050197816 9:3106926-3106948 CAGTCTGTCTGGAGTGAAGCAGG - Intergenic
1050203425 9:3173432-3173454 CATTTGGCCTGTAGTAGAGTTGG - Intergenic
1051735292 9:20191843-20191865 CATGCTGCCTCAAGTATAGTTGG - Intergenic
1054874479 9:70080996-70081018 TTTTCTGCCTGGCATAAAGTAGG + Intronic
1055722113 9:79186749-79186771 CACTCAGCCTGGAGTGCAGTGGG + Intergenic
1056679920 9:88708238-88708260 AGTTCTGCCTGGTGGAAAGTAGG + Intergenic
1056872048 9:90290777-90290799 CAATCAGCCTGGAGTAAATCTGG + Intergenic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1057902582 9:98961102-98961124 CATTCTGCCTGTTGTAACCTGGG + Intronic
1058931801 9:109727624-109727646 CATTTTGCCTCTAGTAAAATGGG - Intronic
1059603243 9:115804276-115804298 CACCCTGGCTGGAGTGAAGTGGG - Intergenic
1060053003 9:120390407-120390429 CATTCTGCCTGGACAAGAGCTGG + Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061652553 9:132062656-132062678 CACTCAGGCTGGAGTACAGTGGG + Intronic
1186496763 X:10016689-10016711 CATTCTGGCTGCAGTACAGAAGG - Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1187322720 X:18255197-18255219 CATTATGCCTGGCATGAAGTAGG - Intronic
1189532063 X:41895387-41895409 TATAATGCCTGGAGTATAGTAGG - Intronic
1192954566 X:76055173-76055195 CATTCTTGCAGGAGTAATGTGGG + Intergenic
1194442233 X:93946780-93946802 CATTCTGACTGGAGTTGAGATGG - Intergenic
1194732301 X:97470036-97470058 CATTCTGCCAGGCATTAAGTGGG + Intronic
1195027820 X:100895747-100895769 CATTCTGCCTTGTGTATACTGGG + Intergenic
1195938292 X:110145657-110145679 CTTGCTGCCTGGAGTGAGGTAGG - Intronic
1196349652 X:114711809-114711831 CACTGTGCCTGGAACAAAGTAGG + Intronic
1196611380 X:117718444-117718466 AATTCTGCCTGGGGTAGAATGGG - Intergenic
1197270048 X:124415366-124415388 AATTCTGGCTGGAGTTAAGAAGG + Intronic
1197303985 X:124818311-124818333 CATTTTGCCTGGAACATAGTAGG - Intronic
1199297863 X:146179766-146179788 TATTCAGCATGGAGTAAAGGAGG + Intergenic
1202363967 Y:24142015-24142037 CATTCAGGCAGGAGTATAGTGGG - Intergenic
1202506813 Y:25528107-25528129 CATTCAGGCAGGAGTATAGTGGG + Intergenic