ID: 1098275685

View in Genome Browser
Species Human (GRCh38)
Location 12:68808787-68808809
Sequence CTGCGGGGCCGCTTCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098275670_1098275685 15 Left 1098275670 12:68808749-68808771 CCGCGGGAGTTCAGGGTAAAGGT 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG 0: 1
1: 0
2: 1
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098275685 Original CRISPR CTGCGGGGCCGCTTCGGCGC GGG Intronic