ID: 1098275685

View in Genome Browser
Species Human (GRCh38)
Location 12:68808787-68808809
Sequence CTGCGGGGCCGCTTCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098275670_1098275685 15 Left 1098275670 12:68808749-68808771 CCGCGGGAGTTCAGGGTAAAGGT 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG 0: 1
1: 0
2: 1
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098275685 Original CRISPR CTGCGGGGCCGCTTCGGCGC GGG Intronic
900135661 1:1115980-1116002 CTGGGCGGCCGGGTCGGCGCAGG - Intronic
900166584 1:1246464-1246486 TCGCGGGGCAGCTTCGGAGCTGG - Intronic
900366616 1:2314375-2314397 CTGCGGGGTCACTGCTGCGCAGG + Intergenic
900671324 1:3856862-3856884 CTTCCGGGCCGCTGCGGCGCCGG - Intronic
904006675 1:27366596-27366618 ATGCGGGGGCGCTCAGGCGCGGG + Exonic
904775087 1:32901431-32901453 CCGCGGGGGCGCTGCGGGGCCGG - Intronic
905990784 1:42335278-42335300 CTGCGGCGTCGCTGCGCCGCCGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
922769585 1:228174857-228174879 CTGCGGGGCTGCATCGCTGCAGG + Exonic
1070954350 10:80454508-80454530 CCGCGGGGCCGCTCCTGGGCAGG - Intronic
1076373903 10:129971347-129971369 CTCCGGGGGTGCGTCGGCGCGGG + Intergenic
1081630729 11:44687932-44687954 CTGCTGGGCTGCTTTTGCGCTGG - Intergenic
1083744955 11:64730205-64730227 TTGCGGGGGCGCTTCAGCTCGGG + Intronic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG + Intronic
1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG + Intronic
1104891789 12:132143776-132143798 ATCTGGGGCCGCCTCGGCGCTGG + Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1105847686 13:24307854-24307876 CTCCGGGGCTGCTGCGGCCCAGG - Intronic
1106050583 13:26186490-26186512 CAGCGGAGACGCTTCGGAGCAGG + Intronic
1114675933 14:24440408-24440430 CTGGGGGGCCCCATCGGCTCAGG - Exonic
1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG + Intergenic
1121546933 14:94769697-94769719 CTGCGGGGCCGTGCCGCCGCTGG - Exonic
1122470898 14:101965117-101965139 CTGCGGGGCGTCTGCGGCCCTGG - Intronic
1122789521 14:104178468-104178490 CTGCGGGGACGCTGCGGAGCCGG - Intronic
1124031466 15:26016192-26016214 CTGGGGGGCTGCTTCGGCTCCGG - Intergenic
1124500466 15:30223357-30223379 CTGCGGCGCGGCTCCGCCGCCGG - Intergenic
1124743108 15:32315310-32315332 CTGCGGCGCGGCTCCGCCGCCGG + Intergenic
1129612218 15:77070419-77070441 CCGCGGGGACGCTGCGGAGCCGG - Intronic
1132251919 15:100341122-100341144 CGGCGGGGCGGCCGCGGCGCCGG + Exonic
1135969188 16:27060064-27060086 CTGCAGGCCCGCTTCGGGGCAGG + Intergenic
1136265978 16:29118690-29118712 CTCTGGGGCTGCTTCGGCCCAGG + Intergenic
1136526437 16:30834384-30834406 GTGCGGGGCGGCTTCTGCGCTGG + Exonic
1139390803 16:66605364-66605386 CTGCGGGGCCGAGCCGGCGGGGG + Intronic
1141665294 16:85462683-85462705 CGGCGGGGGCGCCGCGGCGCGGG + Intergenic
1142764329 17:2057105-2057127 CTGCGGGGCGGCGGCGGCGGCGG + Exonic
1144813698 17:18018613-18018635 CTGCGGGCCCGCACCGCCGCCGG - Exonic
1147028461 17:37609540-37609562 CTGGGGGACCCCTGCGGCGCCGG - Intergenic
1147720309 17:42536057-42536079 CAGCGGGTCCCCTTCGGCCCTGG + Intergenic
1149994810 17:61400844-61400866 CCGCGGGGCCTCCTCTGCGCTGG - Intronic
1152362533 17:79839332-79839354 CGGCGGGGGCGCTTCGGCCGGGG - Exonic
1152744212 17:82031684-82031706 GTCCGCGGCCGCTGCGGCGCCGG + Exonic
1153636649 18:7118121-7118143 CTGCAGGGCCGCGGCGGGGCGGG - Intergenic
1160053154 18:75455611-75455633 CTGCGGGGCCCTGTCGGCGGTGG + Intergenic
1160583264 18:79899683-79899705 CTGCAGGGCCGGCTCGGGGCTGG - Exonic
1160909360 19:1467711-1467733 CTGCGGGGGCGCTCGGGGGCCGG - Exonic
1162481437 19:10929054-10929076 CTGCAGGGACGCTTCGGCGGAGG + Exonic
1162609524 19:11738588-11738610 CTGCTCGGCCGCTGCGGCCCCGG - Intronic
1162612512 19:11767383-11767405 CTGCGCGGCCACTGCGGCCCTGG + Intronic
1163509455 19:17726407-17726429 CTGCGAGGCCGCGTCGCGGCTGG + Exonic
1165956951 19:39507068-39507090 CTGCGCTGCCGCTGCCGCGCCGG + Exonic
1167042739 19:47032279-47032301 CTGCGGGGCCGCGGCGGCCTGGG - Exonic
1167145814 19:47680459-47680481 CGGCGGGGCCGCTCCGGTGGTGG - Exonic
926018495 2:9474688-9474710 CTGCGGGGTCGCTGCCGAGCAGG + Intronic
928904728 2:36356660-36356682 CTGCGCCGCCCCCTCGGCGCTGG + Intronic
929000834 2:37345227-37345249 CTCCGGGGCCGCTAGGGTGCGGG + Intronic
931719466 2:65056644-65056666 CTGCGGGGCCCTTGCGGTGCGGG + Intronic
932449757 2:71802034-71802056 CTGTGGGGCCTCTTCTGCTCTGG - Intergenic
933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG + Exonic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
939900514 2:147844627-147844649 CGGCGAGGCGGCTGCGGCGCGGG - Exonic
942454837 2:176130500-176130522 CTGCAGGGCTGCTGCGGCGGCGG - Exonic
947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG + Exonic
1171974880 20:31587999-31588021 CTTTGGGGACGCCTCGGCGCTGG - Intergenic
1175847003 20:62064796-62064818 CGGCGCGGCGGCTGCGGCGCCGG - Exonic
1175951794 20:62587607-62587629 CTGCGGGGCAGCATGGGCACAGG + Intergenic
1176030046 20:63007371-63007393 CTGAGGGGCCGCTTCGGGTCGGG + Intergenic
1176129075 20:63488609-63488631 CTGCGGGGCGGCCACGGGGCGGG + Intronic
1179561579 21:42219186-42219208 CTGCGGGGCCGAGGCTGCGCTGG - Exonic
1182771815 22:32801810-32801832 CAGCGAGGCTGCCTCGGCGCTGG - Exonic
1184687220 22:46102139-46102161 CTGCGGGGCAGCTTGGGGCCAGG - Intronic
1185020450 22:48371610-48371632 CTGCAGGGCAGCTGCGGCCCAGG + Intergenic
950046629 3:9952104-9952126 TTGCGGGGCAGCCTCGGAGCTGG + Intronic
950119530 3:10472412-10472434 CTGGGGGGACGCTGCGGGGCAGG + Intronic
950902993 3:16513695-16513717 CGGCGGGGGCGCGTCGGGGCTGG - Exonic
954151031 3:48657204-48657226 CTGCTGGGCCGCTTCCTCGAGGG - Exonic
955916370 3:63912254-63912276 GAGCCGGGCCGCTCCGGCGCTGG + Intronic
956761374 3:72447447-72447469 CCCCGGGGCGGCTTCGGGGCCGG - Intergenic
960864289 3:122184301-122184323 CTGGGCGGCCGCTGCGGCCCCGG - Intronic
968815321 4:2818648-2818670 CTGCGGGGCTCCTTCGGGCCGGG + Intronic
975167000 4:71187706-71187728 CTGCGGGGCCAGTTCTGCGGCGG + Intronic
975392639 4:73836895-73836917 CTGCGGGGCCGCTGCGTTCCAGG + Intronic
984778653 4:183505084-183505106 CTGCGGGGTCCCCGCGGCGCCGG + Exonic
985513095 5:322838-322860 CTGGGGAGCCGCTTCGACGGGGG + Intronic
986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG + Intergenic
992962754 5:81972189-81972211 CTGCGAGGCCACTGCCGCGCCGG - Exonic
995512332 5:112921843-112921865 CTGGAGGGCAGCTGCGGCGCCGG - Intronic
1003139158 6:3456756-3456778 CTGCGGCCCCGCTCGGGCGCCGG + Intronic
1005987714 6:30884647-30884669 GAGCGGGGCCTCTTCGGCGGCGG - Intronic
1007585100 6:42984627-42984649 CTGCGGCCCCGCTCCGGCTCCGG - Exonic
1010221407 6:73451924-73451946 CTGAGGGGCCTTTTTGGCGCGGG + Exonic
1023883281 7:44333807-44333829 CTGCGGGGCAGCCTCAGCACTGG - Intronic
1032238004 7:130141245-130141267 GTGCGGGGCCGCCTCTTCGCGGG - Intergenic
1039887244 8:41661885-41661907 CTCCTGGGCGGCATCGGCGCTGG + Exonic
1045231433 8:100310277-100310299 CAGCGGGGCGGCTCCTGCGCGGG - Intronic
1057478648 9:95426810-95426832 CTGCGCGGCGGCTGCGGCTCTGG + Intergenic
1059102657 9:111484484-111484506 GTCGGGGGCCGCTGCGGCGCAGG - Exonic
1059145548 9:111896680-111896702 CCGCGCGCCCGCTGCGGCGCCGG - Intergenic
1060478029 9:123999941-123999963 CTGCGGGGCCGGCCCGGAGCCGG - Intergenic
1061128244 9:128689842-128689864 CAGCGCGGCCGCCGCGGCGCGGG - Intronic
1061489816 9:130938729-130938751 CTCCCGGGCCGCCCCGGCGCGGG - Exonic
1061750939 9:132776603-132776625 CTGCGGGGCCGCCACGCTGCAGG + Intronic
1062364790 9:136203410-136203432 CCTCTGGGCCGCTCCGGCGCAGG - Intronic
1062462115 9:136666362-136666384 CTGCGGGGCTGCTGCCGGGCAGG + Intronic
1188003452 X:25002433-25002455 CCGCCCGGCAGCTTCGGCGCTGG - Intergenic
1188553331 X:31384244-31384266 CTGCATAGCCGCTTCGGTGCTGG - Intronic
1198767085 X:140091313-140091335 CTGCGGGGCCGCAGCGGCGGCGG + Intergenic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1200267313 X:154653299-154653321 TGGCGGTGCCGCTTCTGCGCAGG - Exonic