ID: 1098277111

View in Genome Browser
Species Human (GRCh38)
Location 12:68823931-68823953
Sequence TGCTTGTGGTGTCCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098277108_1098277111 0 Left 1098277108 12:68823908-68823930 CCTACATTCCAGTAATAATGAAC 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 78
1098277107_1098277111 4 Left 1098277107 12:68823904-68823926 CCTGCCTACATTCCAGTAATAAT 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 78
1098277105_1098277111 28 Left 1098277105 12:68823880-68823902 CCACAGGATCCTTTACAGTCTGA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 78
1098277109_1098277111 -8 Left 1098277109 12:68823916-68823938 CCAGTAATAATGAACTGCTTGTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 78
1098277106_1098277111 19 Left 1098277106 12:68823889-68823911 CCTTTACAGTCTGAACCTGCCTA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098277111 Original CRISPR TGCTTGTGGTGTCCTGCAAC AGG Intronic
903832871 1:26184992-26185014 AGCTTGTGCTGTGCTGCTACAGG + Exonic
909518680 1:76541810-76541832 TGCCTGTGGCATTCTGCAACAGG - Intronic
918383632 1:183983619-183983641 TGCTTGTGGAGTGCTGCAGCAGG - Intronic
920740227 1:208574957-208574979 TGATTATGGTGTCCAGCACCTGG - Intergenic
921462733 1:215448046-215448068 TTCTAGTTGGGTCCTGCAACGGG + Intergenic
922424690 1:225481919-225481941 TGCATGGGCTGTTCTGCAACAGG - Intergenic
924442573 1:244098680-244098702 TGCTATTACTGTCCTGCAACTGG + Intergenic
1064093178 10:12402649-12402671 TGCTCGTGGAGTCCTGGAACAGG + Intronic
1070468680 10:76754125-76754147 TGCTTGTAGTGTTCTGCATATGG - Intergenic
1076384455 10:130046381-130046403 TCCGTGTGGGGTCCCGCAACTGG - Intergenic
1078941963 11:16016572-16016594 TTTTTGTTGTGTCCTGCATCTGG - Intronic
1084630636 11:70346274-70346296 TGTGTGTGGAGTCCTGCAGCAGG + Intronic
1090521525 11:127484995-127485017 TGCTTCTGCTGTCCTGGAGCTGG + Intergenic
1090955738 11:131511653-131511675 TCATTCTGGTGTCCTGCAACTGG - Intronic
1091654499 12:2335622-2335644 TGCTTGCCCTGTCCTGCACCTGG - Intronic
1092604026 12:10099699-10099721 TGTTTGTGCTGACCTACAACAGG + Intronic
1098277111 12:68823931-68823953 TGCTTGTGGTGTCCTGCAACAGG + Intronic
1099926155 12:89020472-89020494 GGTTTGTAGTGTCCAGCAACTGG + Intergenic
1101168029 12:102059626-102059648 TGTTTGAGCTGTCCTGAAACAGG - Intronic
1102869158 12:116399973-116399995 TGCTTGTGGTGTATTCCAGCTGG - Intergenic
1106319549 13:28624907-28624929 TGGTTGTAGTGTCCTGCAAGTGG - Intergenic
1109030785 13:57184658-57184680 TGCATGTGGGTTCCTCCAACAGG + Intergenic
1117555388 14:56878321-56878343 AGCTGGTGGTGCCCTGCAAGTGG + Intergenic
1118332949 14:64827938-64827960 TGCTGGTGGTGTCCATCGACTGG - Intronic
1122053749 14:99078412-99078434 TACTTGGGGTGTCCTGCAGGTGG + Intergenic
1125828212 15:42693357-42693379 AGCTTCTGGTGGCCTTCAACAGG - Exonic
1126329885 15:47520863-47520885 TGTTTGTGGTGTCCTGGTGCTGG + Intronic
1133500004 16:6357022-6357044 TGATTCTGCTGTCCTGCACCCGG + Intronic
1141115470 16:81304967-81304989 TGCTTGAGGTGTCCACCATCGGG - Intergenic
1150219205 17:63486628-63486650 TGATAGTGGTGTTCTGCAACTGG - Exonic
1153408764 18:4770105-4770127 TGGCTGTGGTGTCCTGGAAATGG + Intergenic
1153632261 18:7082908-7082930 TTCTTTTGATGTCCTGCAACTGG - Intronic
1159803733 18:72929384-72929406 GGGTTGTGGGGTCCAGCAACAGG - Intergenic
1164694755 19:30235001-30235023 TGCTTGTGGTTTCCAGGTACAGG + Intronic
1166251378 19:41573229-41573251 GGCTGGTGCTGTCCTGCAGCAGG - Intronic
925143065 2:1563323-1563345 TGCTGGTGATGTCCTGAAAGAGG + Intergenic
926076336 2:9946130-9946152 TGCTTGGGGAGTCCTCCTACTGG + Intergenic
926384552 2:12323516-12323538 AGCTTGTGGAGTCCAGCCACTGG + Intergenic
936510486 2:113141336-113141358 TGCTGATGGTCTCCTGCACCTGG - Intergenic
947210833 2:227707110-227707132 CTCATGTGGTGTGCTGCAACAGG - Intronic
1170614093 20:17935199-17935221 AGCCTGGGGTGTCCTGGAACAGG + Intergenic
1170644952 20:18189795-18189817 TCCTTGTGGTGTCCTTCATGGGG + Intergenic
1175922633 20:62457266-62457288 GGCTCGTGCTGTCCTGCCACAGG - Intergenic
1178812191 21:35894335-35894357 AGCTTGTGGGTTCCTCCAACGGG + Intronic
1182130419 22:27846169-27846191 TGCTTGTGGCGTTCAGCAAGGGG - Intergenic
1182584202 22:31334420-31334442 TGTTCTTGGTGTCCTGGAACTGG - Intronic
949887358 3:8706877-8706899 TGCTTGTGGTGATCTGGGACCGG + Intronic
956780253 3:72597827-72597849 TGCCTGTGCTGTCCTCCCACGGG + Intergenic
958681376 3:97336102-97336124 TGCTTTAGGAGTCATGCAACTGG - Intronic
961213210 3:125141446-125141468 TGCTTGGGGTGCCCAGCAGCCGG + Intronic
962384424 3:134921320-134921342 TGCTTGAGGTTTCCTGGAAAGGG - Intronic
963717568 3:148821516-148821538 GGCTTGTGGTGTGCTGTAATTGG - Intronic
968790573 4:2658440-2658462 TGCTAGTGATGTCCTGTATCTGG + Intronic
971208261 4:24591022-24591044 AGCATGTGGTGTACTGCAAAAGG + Intergenic
971448836 4:26780648-26780670 GGCTTCTGGTCTCCTGCAACTGG + Intergenic
973051525 4:45604955-45604977 TGTTTTTGGTGACTTGCAACCGG - Intergenic
977116172 4:93031417-93031439 TGCTTGTGGTGTCAGGCAGCAGG - Intronic
978564250 4:110065064-110065086 TGTTTGTTGTCTCCTGCAATAGG - Intronic
979308165 4:119172635-119172657 TGGTTTAGGTGTCTTGCAACTGG - Intronic
981538926 4:145828160-145828182 TGTTTGTACTGTCCTCCAACTGG + Intronic
986076934 5:4347469-4347491 TGCTTATGGTAACGTGCAACGGG - Intergenic
986693983 5:10335896-10335918 TGCCTCTGGTGTGCTGCAGCAGG + Intergenic
989311413 5:40023425-40023447 TGGGTGTGGTGGCATGCAACTGG - Intergenic
990580071 5:57159708-57159730 TGGGTGTGGTGTCCTACACCCGG - Intergenic
999319316 5:150603613-150603635 TTCTTGTCTTGTCCTGCAACAGG + Intronic
1014319780 6:119912770-119912792 TTATTGTGGTGGTCTGCAACTGG + Intergenic
1015755243 6:136599811-136599833 TGCTTCTGGTGTCCTAAAATGGG - Intronic
1017077436 6:150631907-150631929 TGCTAGTGCTGTCCTGCCCCGGG + Intronic
1019396425 7:821929-821951 TGCTTGTGTTGCCCTGCCAGAGG + Intronic
1020116929 7:5481365-5481387 TGTTTGTGGTCACCTGCCACCGG - Exonic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024497701 7:50067238-50067260 TGGTTGTGATGTGCTGCAAGGGG - Intronic
1034316669 7:150139440-150139462 AGCTTGTGGATTCCTGCCACAGG + Intergenic
1034790195 7:153961242-153961264 AGCTTGTGGATTCCTGCCACAGG - Intronic
1036800728 8:11789121-11789143 TGCGTGTGGTCTGCTCCAACTGG + Intergenic
1037764871 8:21766531-21766553 TGTTTGGGGCGTCCTGCGACTGG - Intronic
1038663288 8:29515713-29515735 TGCTTGTGTTGATCTGCAGCCGG - Intergenic
1040888866 8:52294470-52294492 TGCTGGGGGTGTCCTAGAACAGG - Intronic
1048197448 8:132343743-132343765 TGCTTGTGGAGACCTCCACCTGG + Intronic
1051880287 9:21833098-21833120 TGCTTGTGGTGGCATGAAAAAGG - Intronic
1054941622 9:70749003-70749025 TGGTTGTGTTGGCATGCAACCGG - Intronic
1061735350 9:132652570-132652592 TGCTTCTGATGTTCTACAACCGG - Intronic
1187046295 X:15650621-15650643 TGTTTGTGGTCTTCTTCAACAGG + Intronic
1190026781 X:46931102-46931124 TGCCTGTGTTTTCCTGCATCTGG + Intronic
1195223581 X:102769363-102769385 TGAGTGTGGTGTCCTGCTCCAGG + Intergenic
1195303386 X:103554730-103554752 TGAATGTGGTGTCCTGCTCCAGG - Intergenic
1198015533 X:132606457-132606479 TGCATGTGGTTTCCTGTATCTGG - Intergenic
1198268691 X:135033654-135033676 GTCCTGTGGTGTCCTGCAAATGG + Intergenic