ID: 1098278421

View in Genome Browser
Species Human (GRCh38)
Location 12:68837245-68837267
Sequence CAAAATGTACAAATTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1686
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 1607}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098278421 Original CRISPR CAAAATGTACAAATTCAGCT GGG (reversed) Intronic
901117487 1:6859626-6859648 CAAAATAAACAAAATTAGCTGGG + Intronic
901188907 1:7392414-7392436 CTAAAAATACAAAATCAGCTGGG - Intronic
901472211 1:9465554-9465576 TAAAATGTACAATTTAGGCTGGG + Intergenic
902307605 1:15554040-15554062 CAAAAAATACAAAATTAGCTGGG + Intronic
902596594 1:17513983-17514005 CTAAAAGTACAAAATTAGCTGGG - Intergenic
902844856 1:19102202-19102224 CAAAAAATACAAAATTAGCTGGG + Intronic
903043232 1:20547809-20547831 CAAAATGTTCTAACTCAACTGGG + Intergenic
903076385 1:20770474-20770496 CAAAAAATACAAAATCAGCAGGG - Intronic
903091268 1:20920065-20920087 CAAAAAATACAAAATTAGCTGGG - Intronic
903299366 1:22367366-22367388 CAAAATATCCACATTCTGCTGGG + Intergenic
903380615 1:22894434-22894456 CTAAAACTACAAAATCAGCTGGG + Intronic
903392538 1:22974714-22974736 TAAAATGTATAAAATCAGCCAGG + Intergenic
903544954 1:24118245-24118267 CTAAAAGTACAAAATTAGCTGGG - Intergenic
903785206 1:25856512-25856534 CTAAAAATACAAATTCACCTGGG + Intronic
903881476 1:26513010-26513032 CTAAAAGTACAAAATTAGCTGGG + Intergenic
903913066 1:26742807-26742829 AAAAATATAAAAATTTAGCTGGG + Intronic
904135840 1:28311981-28312003 CAAAAAATACAAAATTAGCTGGG + Intergenic
904393510 1:30201787-30201809 CTAAAAGTACAAAATTAGCTGGG - Intergenic
904451600 1:30616414-30616436 CAAAATATAAAAAATTAGCTGGG - Intergenic
904540040 1:31226683-31226705 CTAAATATACAAAATTAGCTGGG - Intronic
904649253 1:31992114-31992136 CTAAATATACAAAATTAGCTGGG - Intergenic
904722288 1:32519433-32519455 CAAAAAATACAAAATTAGCTGGG - Intronic
904733867 1:32615295-32615317 CTAAAAGTACAAAATTAGCTGGG - Intronic
904759229 1:32789747-32789769 AAATATATAAAAATTCAGCTGGG - Intronic
905158763 1:36012766-36012788 CAAAATTAACATTTTCAGCTGGG + Intronic
905618467 1:39418700-39418722 CAAAAAATACAAAATTAGCTGGG + Intronic
905634109 1:39537856-39537878 CAAAAATTACAAAATTAGCTGGG - Intergenic
905691184 1:39944205-39944227 AAAAATGCAAAAAATCAGCTGGG - Intergenic
905735246 1:40320552-40320574 CAAAATATAAAAAATTAGCTGGG - Intergenic
906002347 1:42437840-42437862 CTAAATATACAAAATTAGCTGGG - Intronic
906077967 1:43066102-43066124 TAAAAAGTACAAAATTAGCTGGG - Intergenic
906135463 1:43497116-43497138 AAAAATATAAAAAATCAGCTGGG - Intergenic
906257271 1:44359800-44359822 CCAACTGTACAAAGTCAGTTTGG + Intergenic
906424237 1:45696617-45696639 CAAAAAATACAAAATTAGCTGGG + Intronic
906470334 1:46124633-46124655 CTAAAAATACAAAATCAGCTGGG + Intronic
906471947 1:46138497-46138519 CAAAATTAAAAAAATCAGCTAGG + Intronic
907127234 1:52061799-52061821 AAAAATACAAAAATTCAGCTGGG - Intronic
907156410 1:52338848-52338870 CTAAAAATACAAAATCAGCTGGG + Intronic
907249422 1:53128314-53128336 CAAAATTTAAAAAATTAGCTGGG + Intronic
907919397 1:58898632-58898654 TAACATGTACAAAGTCACCTAGG - Intergenic
908221957 1:62015948-62015970 AAAAATACAAAAATTCAGCTGGG - Intronic
908245252 1:62222716-62222738 CTAAATATACAAAATTAGCTGGG + Intergenic
908359191 1:63350940-63350962 CAAAAAATACAAAATTAGCTGGG + Intergenic
908454923 1:64294237-64294259 CTAAAAGTACAAAATTAGCTGGG + Intergenic
908843131 1:68298377-68298399 CAAAAAGTAAAAAATTAGCTAGG - Intergenic
908847443 1:68339201-68339223 CTAAATATACAAAATTAGCTGGG + Intergenic
908975283 1:69889644-69889666 AAAAATATACAAAATTAGCTAGG + Intronic
909144908 1:71917850-71917872 CAAAAAGCACAAATTGAGTTAGG + Intronic
909444261 1:75730676-75730698 AAAAATTTAAAAAATCAGCTAGG - Intronic
909743696 1:79065814-79065836 CTAAAAGTACAAAATTAGCTGGG - Intergenic
909954647 1:81763843-81763865 CTAAATATACAAAATTAGCTGGG + Intronic
910006374 1:82402119-82402141 CCAAAAGTACAAAATTAGCTGGG - Intergenic
910219973 1:84880167-84880189 TAAAAAGTACAAAATTAGCTGGG + Intronic
910271104 1:85395509-85395531 CTAAAAATACAAAATCAGCTGGG + Intronic
910396078 1:86795071-86795093 CTAAATATACAAAATTAGCTAGG + Intergenic
910424174 1:87102217-87102239 CTAAAAATACAAAATCAGCTGGG - Intronic
910784407 1:90979310-90979332 TAAAAAATACAAATTTAGCTGGG + Intronic
910823904 1:91384902-91384924 AAAAATGTAAAAAATTAGCTGGG - Intronic
910863513 1:91766331-91766353 TAAAATGTAGAAATTAGGCTAGG - Intronic
911212064 1:95152290-95152312 CAAAATGCACAAAATGACCTGGG - Intronic
911233376 1:95383759-95383781 CAAAATGTACCTATTAAGTTGGG - Intergenic
911578711 1:99609696-99609718 CAAACTATAAAAAATCAGCTTGG - Intergenic
911660965 1:100500594-100500616 CAAAAAATACAAAATTAGCTGGG + Intronic
911875376 1:103155665-103155687 CAAAAAATACAAAATTAGCTGGG - Intergenic
911886018 1:103300687-103300709 GAAAATATACAAAATTAGCTGGG + Intergenic
912019658 1:105091196-105091218 CAAAAAGTAAAAACTTAGCTGGG + Intergenic
912128191 1:106567103-106567125 CAATATGTTCTAATTCAGATAGG + Intergenic
912166494 1:107047742-107047764 CAAAATGCACAAATAAAGCAAGG + Intergenic
912408106 1:109459162-109459184 AAAAATTTAAAAATTCTGCTCGG - Intergenic
912448615 1:109756397-109756419 CTAAATATACAAAATTAGCTGGG - Intronic
912462831 1:109848108-109848130 CAAAAAGTAAAAAATTAGCTGGG + Intergenic
912627624 1:111219245-111219267 CAAAATGTTCAAGTTGAGCGGGG - Intronic
912749417 1:112273383-112273405 CACACAGTAAAAATTCAGCTTGG + Intergenic
912850901 1:113123411-113123433 CTAAATATACAAAATTAGCTGGG + Intronic
912991489 1:114491641-114491663 AAAAATGTAAAAAATTAGCTGGG + Intronic
913143423 1:115964993-115965015 CTAAAAATACAAATTTAGCTGGG + Intergenic
913166433 1:116191234-116191256 CAAAAGCTACAAAATTAGCTGGG + Intergenic
913377221 1:118165804-118165826 CAAAAAATACAAAATTAGCTGGG - Intronic
913390204 1:118302203-118302225 CAAAATCTAAAAATTAACCTGGG - Intergenic
913557561 1:119983312-119983334 CAAAAAATACAAAATTAGCTGGG - Intronic
913941616 1:125114334-125114356 CAGAATCTACAAATTCCTCTGGG - Intergenic
913970973 1:143417413-143417435 TAAAAAATACAAAATCAGCTGGG + Intergenic
914065351 1:144243024-144243046 TAAAAAATACAAAATCAGCTGGG + Intergenic
914113800 1:144723330-144723352 TAAAAAATACAAAATCAGCTGGG - Intergenic
914749682 1:150526187-150526209 AAAAATATAAAAAATCAGCTGGG + Intergenic
914806026 1:150992386-150992408 CTAAATATACAAAATTAGCTAGG + Intronic
914830540 1:151167670-151167692 AAAAATGTAAAAAATTAGCTGGG + Intronic
915132478 1:153705313-153705335 CTAAAAGTACAAAATTAGCTGGG - Intergenic
915157634 1:153891406-153891428 CAAAATATAAAAAATTAGCTAGG + Intronic
915318733 1:155044320-155044342 AAAAATGAACAAAATCAGCCAGG + Intronic
915429824 1:155857566-155857588 CTAAATATACAAAATTAGCTGGG + Intronic
915578024 1:156794116-156794138 CTAAAAATACAAAATCAGCTGGG - Intronic
915687373 1:157647633-157647655 CAGAATCTACAAATTCACTTGGG + Intergenic
916179822 1:162073619-162073641 CAAAAAATACAAAATTAGCTGGG - Intronic
916236302 1:162592227-162592249 CTAAATATACAAAATTAGCTGGG + Intronic
916316173 1:163450633-163450655 CATAATGAACTAATTCACCTGGG + Intergenic
916531257 1:165658884-165658906 CAAAATATACAAAATTAGCTGGG + Intronic
916560082 1:165927018-165927040 AAAAAAGAACAAAATCAGCTGGG - Intergenic
916639993 1:166717486-166717508 CAAAATGTACAAACAAAGCAAGG - Intergenic
917090402 1:171347595-171347617 CAAAAAGTACAAAATTAGCCAGG + Intergenic
917388978 1:174511781-174511803 CTAAAAATACAAAATCAGCTGGG - Intronic
917575892 1:176321497-176321519 AAAAAGGTAAAAATTCACCTGGG - Intergenic
917862602 1:179161548-179161570 AAAAATGAATAAAATCAGCTAGG + Intronic
917955435 1:180091667-180091689 CAAAACATACAAAGTTAGCTGGG + Intronic
917983936 1:180295581-180295603 CAAAATGAACAAATGCTGTTGGG - Intronic
918902654 1:190444069-190444091 CTAAAAGTACAAAATTAGCTGGG + Intronic
919013814 1:192002090-192002112 AAAAACATACAAAATCAGCTGGG + Intergenic
919139903 1:193557378-193557400 CTAAAAATACAAAATCAGCTGGG + Intergenic
919364514 1:196640281-196640303 AAAAATGTAAAAATTAATCTGGG - Intergenic
919637761 1:200019874-200019896 CTAAAAGTACAAAATTAGCTGGG - Intergenic
919691863 1:200534945-200534967 AAAAATTTAAAAAATCAGCTGGG + Intergenic
919740421 1:200977893-200977915 CTAAAAATACAAAATCAGCTTGG - Intronic
920001187 1:202800203-202800225 CCAAAAGTACAAAATTAGCTGGG - Intronic
920161797 1:204004279-204004301 CAAAAAATACAAAATTAGCTGGG + Intergenic
920785848 1:209040340-209040362 AAAAATGTCCAAAGTCAGCTGGG - Intergenic
920919822 1:210289315-210289337 AAAAATGAACAAAATTAGCTGGG - Intergenic
921475405 1:215601096-215601118 CTAAATATACAAAATTAGCTGGG - Intronic
921598501 1:217081386-217081408 CTAAAAATACAAAATCAGCTGGG - Intronic
922252467 1:223862490-223862512 CAAAAAATACAAAATTAGCTGGG - Intergenic
922263443 1:223962916-223962938 CTAAATATACAAAATCAGCTGGG + Intergenic
922490696 1:226014157-226014179 CTAAAAGTACAAAATTAGCTGGG + Intergenic
922584266 1:226721972-226721994 CTAAAAATACAAAATCAGCTGGG - Intronic
922761990 1:228139011-228139033 CTAAAAATACAAAATCAGCTGGG - Intergenic
922842952 1:228659215-228659237 CTAAAAATACAAAATCAGCTGGG + Intergenic
923032257 1:230258388-230258410 CTAAAAATACAAAATCAGCTGGG - Intronic
923053417 1:230404770-230404792 CAAAAAATACAAAATTAGCTGGG + Intronic
923109243 1:230877846-230877868 CTAAATGTAAACATTCAGGTAGG - Intergenic
923267272 1:232327056-232327078 AAAAATATAAAAATTTAGCTGGG - Intergenic
923653761 1:235897977-235897999 CTAAAAGTACAAAATTAGCTGGG - Intergenic
923707822 1:236359510-236359532 AAAAATGGACTAATACAGCTGGG - Intronic
923734610 1:236593031-236593053 CTAAATATACAAAATTAGCTGGG + Intronic
924235247 1:241994646-241994668 CAAAAAATACAAAATTAGCTGGG + Intergenic
924354556 1:243157702-243157724 CAAAAACTACATTTTCAGCTGGG + Intronic
924562884 1:245171775-245171797 CAAAATATACAAATCCTGATGGG - Intronic
924725356 1:246664585-246664607 AAAAATATAAAAAATCAGCTGGG - Intronic
924766846 1:247040854-247040876 CTAAAAATACAAAATCAGCTGGG - Intronic
924928424 1:248705766-248705788 CTAAAAATACAAAATCAGCTGGG + Intergenic
1062863949 10:833726-833748 CTAAAAGTACAAAATTAGCTTGG + Intronic
1063001352 10:1926692-1926714 AAAAATTTTCAAAATCAGCTGGG + Intergenic
1063239330 10:4152126-4152148 CAAAATATACAAATCCAACATGG - Intergenic
1063265778 10:4448928-4448950 CTAAAAATACAAATTTAGCTGGG + Intergenic
1063826555 10:9904981-9905003 GAAAGTATACAAATTTAGCTTGG + Intergenic
1063829372 10:9934487-9934509 CTAAAAATACAAAATCAGCTGGG - Intergenic
1064049896 10:12051031-12051053 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1064060970 10:12136923-12136945 AAAAATACAAAAATTCAGCTGGG - Intronic
1064083625 10:12328384-12328406 TAAAATATAAAAAATCAGCTGGG - Intergenic
1064480383 10:15734877-15734899 CCAAAAATACAAATTTAGCTAGG - Intergenic
1064577581 10:16761693-16761715 AAAAATGTAAAAAATTAGCTGGG + Intronic
1065045139 10:21740624-21740646 TAAAATGTATATATTCATCTTGG - Intronic
1065315989 10:24464644-24464666 CAAAAAGTAAAAACTTAGCTGGG - Intronic
1065582755 10:27188096-27188118 CAAAATGTACAAATTTAAAATGG + Intergenic
1066118084 10:32257823-32257845 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1066118365 10:32260129-32260151 CTAAAAGTACAAAATTAGCTAGG - Intergenic
1066186002 10:33011129-33011151 CAAAAAGTACAAAATCAACCAGG - Intergenic
1066293838 10:34037032-34037054 AAAAATTTAAAAATTTAGCTGGG - Intergenic
1066335929 10:34478702-34478724 CTAAATATACAAAATTAGCTGGG - Intronic
1066352073 10:34645012-34645034 CAAAATATAAAAAATTAGCTGGG - Intronic
1066553619 10:36586786-36586808 CTAAACGTACAAAATTAGCTGGG + Intergenic
1066782320 10:38965880-38965902 CAGAATCTACAAATTCCTCTGGG - Intergenic
1066951077 10:42117211-42117233 CAGAATCTACAAATTCCTCTGGG + Intergenic
1067204900 10:44204203-44204225 CTAAAAATACAAAATCAGCTGGG + Intergenic
1067826165 10:49574820-49574842 CAAAATATACATAATTAGCTGGG + Intergenic
1067997907 10:51296583-51296605 CAAAATCAACAAACTCAGCTAGG - Intronic
1069003132 10:63288038-63288060 AAAAATTTAAAAATTTAGCTGGG - Intronic
1069155358 10:65022989-65023011 CACAATGGACAAACACAGCTTGG - Intergenic
1069382625 10:67856342-67856364 CAAAAAATACAAAATTAGCTGGG - Intergenic
1069575763 10:69527432-69527454 CTAAATCTACAAAATTAGCTGGG + Intergenic
1069752826 10:70755144-70755166 AAAAATGTAAAAAGTTAGCTGGG + Intronic
1070184947 10:74052535-74052557 CAAAATACAAAAAATCAGCTGGG - Intronic
1070269841 10:74942602-74942624 CTAAAAGTACAAAATTAGCTGGG + Intronic
1070293198 10:75135289-75135311 CTAAAAATACAAATTTAGCTGGG + Intronic
1070501739 10:77079107-77079129 CTAAAAGTACAAAATCAGCCTGG + Intronic
1071046400 10:81384645-81384667 CAAAATATAAAAAATTAGCTGGG + Intergenic
1071047236 10:81396113-81396135 AAAAATGTAAAAATTTAGCTGGG - Intergenic
1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG + Intergenic
1071810803 10:89178786-89178808 TGAAATGTACACATTCATCTTGG + Intergenic
1072197456 10:93128594-93128616 CTAAAAATACAAAATCAGCTGGG + Intergenic
1072219969 10:93318595-93318617 CTAAAAGTACAAAATTAGCTGGG + Intronic
1072476565 10:95767038-95767060 CAAAAAATAAAAAATCAGCTGGG - Intronic
1072489213 10:95887337-95887359 CAAAAAATAAAAATTTAGCTGGG - Intronic
1072943412 10:99787765-99787787 CAAAAAGTACAAAAGGAGCTGGG + Intronic
1073019559 10:100431754-100431776 CTAAAAATACAAAATCAGCTGGG - Intergenic
1073024263 10:100475077-100475099 CAAAAATTACAAAATTAGCTGGG + Intronic
1073056276 10:100704948-100704970 CAAAAAATACAAAATTAGCTGGG - Intergenic
1073109336 10:101051602-101051624 CAAAAAGTAAAAAATTAGCTGGG - Intergenic
1073313613 10:102562361-102562383 AAAAATATAAAAATTTAGCTGGG + Intronic
1073567782 10:104550129-104550151 CAAAAAATACAAAATTAGCTGGG - Intergenic
1074054321 10:109908439-109908461 CAAAATATAAAAAATCAGCCAGG + Intronic
1074404959 10:113173010-113173032 AAAAATGTAAAAATTTAGCTGGG + Intergenic
1074907437 10:117877492-117877514 CAAAAAATACAAAATTAGCTGGG - Intergenic
1075000236 10:118791532-118791554 AAAAATTTACAAATGCAGCCGGG + Intergenic
1075034692 10:119054565-119054587 AAAAAAGTACAAAATTAGCTGGG + Intronic
1075174588 10:120147730-120147752 CAAAAAATACAAAATTAGCTGGG - Intergenic
1075370815 10:121933332-121933354 CTAAATATACAAAATTAGCTGGG - Intergenic
1075385886 10:122055057-122055079 TAAAATGCAAAAATTTAGCTGGG + Intronic
1075422688 10:122314341-122314363 AAAAATGTAAAAAATTAGCTGGG + Intronic
1075507376 10:123036246-123036268 CTAAAAGTACAAAATTAGCTGGG - Intronic
1075603994 10:123791253-123791275 CAAAAACTACAAAATTAGCTGGG + Intronic
1075624674 10:123953580-123953602 AAAAATATAAAAAATCAGCTGGG + Intergenic
1075766921 10:124900445-124900467 CAAAAAATACAAAATTAGCTGGG + Intergenic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1077025021 11:436226-436248 CTAAAAATACAAAATCAGCTGGG - Intronic
1077161448 11:1114523-1114545 CTAAAAATACAAAATCAGCTGGG - Intergenic
1077624034 11:3754263-3754285 CAAAATATACAAAATTAGCCGGG + Intronic
1077629138 11:3798802-3798824 CTAAAAATACAAAATCAGCTGGG - Intronic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078162859 11:8856912-8856934 CAAAAAGTAAAAAATTAGCTGGG - Intronic
1078499640 11:11858173-11858195 CAAAATGTACAAAAGAAGCAAGG - Intronic
1078791999 11:14552984-14553006 CAAAAAGTAAAAAGTTAGCTGGG - Intronic
1078810931 11:14762260-14762282 CAAGAAGTACAAAATCAGCTGGG - Intronic
1078890211 11:15548897-15548919 CCAAAAATACAAAATCAGCTGGG - Intergenic
1079402298 11:20115469-20115491 AAAAATATAAAAATTTAGCTGGG + Intronic
1080018830 11:27537245-27537267 AAAAATTTACAAAATTAGCTGGG - Intergenic
1080266572 11:30407708-30407730 CAAAAATTACAAAATTAGCTGGG + Intronic
1080524733 11:33103781-33103803 AAATATGTACAGATTCATCTGGG + Intronic
1080630540 11:34070861-34070883 CTAAAAATACAAAATCAGCTGGG - Intronic
1081184776 11:40028892-40028914 CTAAATATACAAAATTAGCTGGG + Intergenic
1081203825 11:40251053-40251075 CAAAATGTACTACTGCTGCTTGG - Intronic
1081290895 11:41324267-41324289 CTAAAAATACAAAATCAGCTGGG + Intronic
1081302480 11:41469227-41469249 CAAAAAATACAAAATTAGCTAGG + Intergenic
1081521820 11:43889186-43889208 CCAAAAATACAAAATCAGCTGGG - Intronic
1081536315 11:43998918-43998940 AAAAATGTAAAAATTTAGCCTGG - Intergenic
1081551495 11:44117128-44117150 CAAAAAATACAAAATTAGCTGGG - Intronic
1082178150 11:49085526-49085548 TGAGATGTACAAATTCAGTTGGG + Intergenic
1082220971 11:49636216-49636238 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1082308995 11:50622085-50622107 CAAAATGTACATTTGCAGATTGG + Intergenic
1082714788 11:56598999-56599021 CAAAATGAAGAAATGTAGCTTGG - Intergenic
1083024687 11:59540606-59540628 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1083045746 11:59733209-59733231 CTAAAAGTACAAAATTAGCTGGG + Intronic
1083398877 11:62410457-62410479 CTAAAAATACAAAATCAGCTGGG - Intronic
1083442455 11:62686150-62686172 AAAAAAATACAAAATCAGCTGGG + Intergenic
1083626753 11:64075831-64075853 AAAAAAGTACAAAATTAGCTGGG - Intronic
1083798105 11:65030046-65030068 AAAAATTTAAAAATTGAGCTAGG - Intronic
1084056026 11:66633649-66633671 CTAAATGTACAAAATTAGCCAGG + Intronic
1084103161 11:66963441-66963463 AAAAAAATACAAAATCAGCTGGG + Intergenic
1084281066 11:68094378-68094400 CAAAAAATACAAAATTAGCTGGG + Intronic
1084329214 11:68420541-68420563 CTAAAAGTACAAAATTAGCTGGG + Intronic
1084691394 11:70729041-70729063 CTAAAAGTACAAAATTAGCTGGG + Intronic
1084865334 11:72051630-72051652 CAAAAAGTACAAAACTAGCTGGG - Intronic
1084906997 11:72356121-72356143 AAAAAAATACAAATTTAGCTGGG + Intronic
1084913475 11:72409814-72409836 CTAAATATACAAAATTAGCTGGG + Intronic
1085060811 11:73445096-73445118 CTAAAAGTACAAAATTAGCTGGG + Intronic
1085148160 11:74222782-74222804 CAAAATGCCCAAATCGAGCTGGG - Intronic
1085177497 11:74503331-74503353 AAAAATATAAAAAATCAGCTGGG + Intronic
1085228673 11:74946120-74946142 AAAAATATAGAAATTTAGCTGGG - Intronic
1085493999 11:76950620-76950642 AAAAATGTAAAAAATTAGCTTGG - Intronic
1085629549 11:78102788-78102810 CTAAAAATACAAAATCAGCTGGG + Intronic
1085646752 11:78228941-78228963 TAAAATGAACAAATCCAGATGGG - Intronic
1085719358 11:78899412-78899434 AAAAATAAACAAAATCAGCTGGG + Intronic
1085801259 11:79591746-79591768 CAAAAAGGGAAAATTCAGCTGGG - Intergenic
1086152843 11:83631810-83631832 CAAATTGGAAAAAGTCAGCTGGG - Intronic
1086198233 11:84167825-84167847 CTAAATATACAAAATTAGCTTGG - Intronic
1086628076 11:88982903-88982925 CTAAAAGTACAAAATTAGCTGGG + Intronic
1086809255 11:91285368-91285390 AAAAAAGTAAAAAATCAGCTGGG - Intergenic
1086893197 11:92282502-92282524 TAAAAAGTACAAAATCAGCTGGG + Intergenic
1086965519 11:93024013-93024035 AAAAATGTATACATTTAGCTAGG + Intergenic
1086988022 11:93271215-93271237 AAAAAAGTAAAAATTTAGCTGGG + Intergenic
1087486142 11:98762056-98762078 CTAAAAATACAAAATCAGCTGGG - Intergenic
1087913653 11:103782202-103782224 CTAAATATACAAAATTAGCTGGG - Intergenic
1088104830 11:106195090-106195112 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1088148760 11:106717541-106717563 AAAAATGTCCAAATTCAAATAGG + Intronic
1088205311 11:107386172-107386194 CAAAAAATAAAAAATCAGCTGGG - Intronic
1088491317 11:110390743-110390765 GAAAATATACAAAATCAGCCTGG - Intergenic
1088633100 11:111793141-111793163 CAAAAAGTAAAAAATTAGCTGGG - Intronic
1088659749 11:112033882-112033904 AAAAATTTAAAAAATCAGCTAGG - Intronic
1088681237 11:112243668-112243690 AAAAATGCAAAAATTTAGCTAGG - Intronic
1089234918 11:117015728-117015750 CTAAAAGTACAAAATTAGCTGGG - Intronic
1089426169 11:118377366-118377388 AAAAAAATACAAAATCAGCTGGG - Intronic
1089446071 11:118553278-118553300 CTAAAAATACAAAATCAGCTGGG + Intronic
1089478388 11:118784905-118784927 CTAAAAGTACAAAATTAGCTGGG - Intronic
1089547688 11:119242375-119242397 CTAAAAATACAAAATCAGCTGGG + Intronic
1089727582 11:120496133-120496155 AAAAATATAAAAAATCAGCTGGG - Intergenic
1090205395 11:124880890-124880912 CAAAAAATACAAAATTAGCTGGG + Intronic
1090291433 11:125548815-125548837 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1090442293 11:126734500-126734522 CGAAAAATACAAAATCAGCTGGG + Intronic
1090862700 11:130668610-130668632 CAAAATGGAGGAATTCAGCCTGG - Intergenic
1091084273 11:132705430-132705452 AAAAAATAACAAATTCAGCTGGG + Intronic
1091430991 12:434511-434533 CTAAATATACAAAATTAGCTGGG - Intronic
1091994302 12:4981216-4981238 CAAAATGTGGAGATCCAGCTGGG + Intergenic
1092147876 12:6227357-6227379 CTAAAAATACAAAATCAGCTGGG - Intronic
1092326807 12:7541259-7541281 GAAAATGTACATATTTAGTTAGG - Intergenic
1092483225 12:8879328-8879350 CTAAATATACAAAATTAGCTGGG + Intronic
1092578618 12:9815977-9815999 CTAAAAATACAAAATCAGCTAGG - Intergenic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1092808961 12:12253981-12254003 CAAAAAATACAAAATTAGCTGGG + Intronic
1093390345 12:18611501-18611523 CCAAATCTACAATTCCAGCTTGG + Intronic
1094026500 12:25965101-25965123 AAAAATGTAAAAAATTAGCTGGG - Intronic
1094065438 12:26356840-26356862 AAAAATGTATAAAATGAGCTGGG - Intronic
1094245366 12:28285504-28285526 CAAAAGGTACATAATGAGCTTGG + Intronic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094539909 12:31354652-31354674 TAAAATGTAAACATTTAGCTGGG + Intergenic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095765334 12:45888032-45888054 AAAAATATAAAAAATCAGCTGGG + Intronic
1096175181 12:49510401-49510423 AAAAATGTAAAAAATTAGCTGGG + Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1096355945 12:50941145-50941167 AAAAATGAAAAAATTCAGCTGGG - Intergenic
1096398289 12:51283831-51283853 CTAAAAGTACAAAATTAGCTGGG + Intronic
1097244060 12:57596322-57596344 CTAAAAGTACAAAATTAGCTGGG + Intronic
1097754117 12:63390128-63390150 CAAAATGCACAAATAAAGCAAGG - Intergenic
1097780090 12:63692493-63692515 CTAAAAATACAAAATCAGCTGGG + Intergenic
1097800386 12:63907375-63907397 AAAAATGTAAAAAATTAGCTGGG + Intronic
1097848800 12:64391351-64391373 TAAAATATACAAAATTAGCTGGG - Intergenic
1098018710 12:66133229-66133251 CTAAATATACAAAATTAGCTGGG - Intronic
1098082617 12:66805135-66805157 AAAAATGTAACAATTGAGCTAGG - Intergenic
1098278421 12:68837245-68837267 CAAAATGTACAAATTCAGCTGGG - Intronic
1098315923 12:69193216-69193238 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1099141426 12:78981286-78981308 CTAAAAGTACAAAATTAGCTGGG - Intronic
1099274029 12:80552283-80552305 CAAAATGTCAAAATCCAGGTAGG + Intronic
1099481627 12:83174066-83174088 AAAAATCTCCAAATTCATCTGGG - Intergenic
1099542134 12:83925219-83925241 CTAAAAATACAAAATCAGCTGGG - Intergenic
1099727828 12:86456772-86456794 TAAAATGTACATTTTTAGCTGGG - Intronic
1100500406 12:95168500-95168522 CTAAAAATACAAAATCAGCTGGG + Intronic
1100546864 12:95611748-95611770 CAATATTCACAAAATCAGCTTGG - Intergenic
1100834384 12:98552468-98552490 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1101015767 12:100498475-100498497 CTAAATATACAAAATTAGCTGGG + Intronic
1101160149 12:101965063-101965085 CTAAAAATACAAATTTAGCTAGG + Intronic
1101374574 12:104160148-104160170 CTAAAAATACAAAATCAGCTGGG + Intergenic
1101422167 12:104558697-104558719 CAAAAAATACAAAATTAGCTGGG - Intronic
1102017079 12:109655246-109655268 AAAAATTAAAAAATTCAGCTGGG - Intergenic
1102172919 12:110855740-110855762 CTAAAAATACAAAATCAGCTGGG - Intronic
1102249911 12:111379661-111379683 CTAAATATACAAAATTAGCTGGG + Intergenic
1102325288 12:111976167-111976189 CTAAAAGTACAAAATTAGCTGGG - Intronic
1102337274 12:112092464-112092486 AAAAATATACAAAATTAGCTGGG + Intronic
1102437154 12:112933589-112933611 TAAAAAGTACAAAAACAGCTGGG + Intergenic
1102463423 12:113114311-113114333 AAAAATGTAAAAACTTAGCTGGG + Intronic
1102661710 12:114534628-114534650 CAAAAACTACAAAATTAGCTGGG - Intergenic
1102705083 12:114874220-114874242 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1102860843 12:116335256-116335278 CTAAAAATACAAATTTAGCTGGG - Intergenic
1103089289 12:118086165-118086187 AAAAAAGCACAAAGTCAGCTGGG + Intronic
1103090756 12:118096415-118096437 CTAAAAATACAAAATCAGCTGGG + Intronic
1103101200 12:118177660-118177682 CTAAAAGTACAAAATTAGCTGGG + Intronic
1103112138 12:118289832-118289854 CTAAAAGTACAAAATTAGCTGGG + Intronic
1103135060 12:118499756-118499778 AGAAATGAAAAAATTCAGCTGGG - Intergenic
1103348978 12:120269946-120269968 CTAAATATACAAAATTAGCTAGG + Intergenic
1103384396 12:120520628-120520650 AAAAATACAAAAATTCAGCTGGG - Intronic
1103429233 12:120867906-120867928 CAAAAGATACAAATTTAGCTGGG - Intronic
1103440551 12:120959639-120959661 CTAAAAATACAAAATCAGCTGGG + Intergenic
1103582144 12:121923316-121923338 AAAAATGAACAAAATTAGCTGGG - Intronic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1103781226 12:123399982-123400004 CTAAAAATACAAAATCAGCTGGG - Intronic
1103787623 12:123445177-123445199 CTAAAAATACAAAATCAGCTGGG + Intergenic
1103818009 12:123674429-123674451 CTAAAAGTACAAAATTAGCTGGG - Intronic
1104063423 12:125286862-125286884 CTAAAAGTAAAAAATCAGCTGGG - Intronic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104716991 12:131022358-131022380 CAAAATGTAGAAATTCATGAAGG - Intronic
1105010893 12:132756004-132756026 CTAAAAGTACAAAATTAGCTGGG - Intronic
1105298840 13:19115416-19115438 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1105370424 13:19797297-19797319 AAAAATGTACAAAATTAGCCAGG + Intergenic
1105691477 13:22844282-22844304 TAAAATGTAAAAAATTAGCTGGG - Intergenic
1105794580 13:23838302-23838324 AAAAATCTAAAAATTTAGCTGGG - Intronic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1106063201 13:26316197-26316219 GAAAATGTAGAAACTTAGCTGGG + Intronic
1106174490 13:27318267-27318289 CTAAAAATACAAAATCAGCTGGG + Intergenic
1106513915 13:30436303-30436325 CAAAATGTACAAATACAATGTGG + Intergenic
1106749992 13:32752913-32752935 TAAAATGTACAACTCTAGCTGGG - Intronic
1107485780 13:40825995-40826017 CTAAAGGTACAAAATTAGCTGGG - Intergenic
1107874940 13:44782228-44782250 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1107925643 13:45259263-45259285 CTAAAAGTACAAAATTAGCTGGG + Intronic
1108079875 13:46724209-46724231 TAAAAATTAAAAATTCAGCTGGG - Intronic
1108267073 13:48722492-48722514 CAAAATATACCAAGTCAGCATGG - Intergenic
1108544523 13:51479444-51479466 CAAGATGTAAATATACAGCTAGG - Intergenic
1108595822 13:51948249-51948271 CAAAAAGTACAAATACAGAATGG - Intronic
1108665751 13:52629034-52629056 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1108831424 13:54484046-54484068 CAAGATTTACAAATTCAACATGG - Intergenic
1108996365 13:56738883-56738905 AAAAATATAAAAATTTAGCTGGG - Intergenic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1109191140 13:59325746-59325768 CAAAATATAAAAAATTAGCTAGG - Intergenic
1109475123 13:62870973-62870995 CAAAAAATACAAAATTAGCTGGG + Intergenic
1109731154 13:66416086-66416108 CAAAATCTACAAAAACAGTTTGG - Intronic
1109801594 13:67386011-67386033 GAAAATGTACATATTCACCATGG - Intergenic
1110261956 13:73495504-73495526 CAAAATGTTCAAAATGAGCTAGG + Intergenic
1110574900 13:77044197-77044219 CAAAAATTACAAAATTAGCTGGG + Intergenic
1110714617 13:78686972-78686994 CTAAATATACAAAATTAGCTGGG - Intergenic
1110855349 13:80291482-80291504 AAAGATATACAAATTCAGCCTGG + Intergenic
1110995869 13:82108756-82108778 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1111108589 13:83676755-83676777 GAAAGGGTAGAAATTCAGCTTGG - Intergenic
1111298490 13:86315857-86315879 CTAAAAATACAAAGTCAGCTGGG - Intergenic
1111366187 13:87248965-87248987 CAAAAAATACAAAATTAGCTGGG - Intergenic
1111659019 13:91186511-91186533 CAAAAATTACGTATTCAGCTGGG + Intergenic
1111742885 13:92226757-92226779 AAAAATGCAAAAAATCAGCTGGG - Intronic
1112184663 13:97116112-97116134 CAAAAAATACAAAATCAGCCAGG - Intergenic
1112282833 13:98077558-98077580 CAAAATATAAAAAATTAGCTGGG + Intergenic
1112551768 13:100428227-100428249 CAAAATAAACAAAATTAGCTGGG - Intronic
1112841966 13:103590947-103590969 CAAAATACAAAAAATCAGCTGGG + Intergenic
1113528687 13:111003340-111003362 CAAAAAATACAAAATTAGCTGGG + Intergenic
1113986783 13:114323921-114323943 GAAAATGTACAAATCCATATGGG + Exonic
1114298193 14:21349561-21349583 CTAAATATACAAAATTAGCTGGG - Intronic
1114326612 14:21595392-21595414 CAAAATACACAAATTAGGCTGGG + Intergenic
1114361808 14:21982505-21982527 TAAAATGTAAAAAATTAGCTGGG + Intergenic
1114507368 14:23227758-23227780 CAAAAAGTACAAAATTAGCCAGG - Intronic
1114569534 14:23656862-23656884 CAAAAAATACAAAATTAGCTGGG + Intergenic
1114649481 14:24275071-24275093 CAAAAAATACAAAATTAGCTGGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115159616 14:30378803-30378825 GGAAATGTACAAGTTCAGCGTGG + Intergenic
1115214902 14:31004610-31004632 CCAAAAATACAAAATCAGCTGGG + Intronic
1115322792 14:32102418-32102440 AAAAATGTAAAATCTCAGCTGGG + Intronic
1115436817 14:33384566-33384588 CTAAAAGTACAAAATTAGCTGGG + Intronic
1115776912 14:36725312-36725334 AAAAATATACAAAATTAGCTGGG + Intronic
1115874252 14:37843238-37843260 CTAAATATACAAAGTTAGCTGGG - Intronic
1116025123 14:39505653-39505675 CAAAAGCTCCAAATTCAGTTTGG - Intergenic
1116163215 14:41297060-41297082 CAAAAAGTACAAATTCACAATGG - Intergenic
1116370205 14:44120985-44121007 TAAAATGACCAAATTAAGCTTGG - Intergenic
1116544283 14:46143769-46143791 CTAAATGTACAGATTCTCCTGGG - Intergenic
1116848292 14:49884570-49884592 CAAAATACAAAAATTTAGCTGGG - Intergenic
1117007365 14:51435278-51435300 CAAAATTTAAAAATTAGGCTGGG + Intergenic
1117356186 14:54925900-54925922 CTAAAAATACAAATTTAGCTGGG + Intergenic
1117429964 14:55647470-55647492 CCAAATGTACAAAATTAGCCAGG + Intronic
1117621750 14:57594348-57594370 CAAAAAATACAAAATTAGCTGGG - Intronic
1117851034 14:59969853-59969875 CAAAATGTACATCTTCAGTTAGG + Intronic
1117976440 14:61301678-61301700 CAAAAAATACAAAATTAGCTGGG + Intronic
1118575554 14:67238802-67238824 CAAAAAATACAAAATTAGCTGGG - Intergenic
1119135467 14:72214335-72214357 AAAAATGCAAAAAATCAGCTGGG - Intronic
1119219444 14:72894021-72894043 AAAAATGTACATATTCCGCGTGG - Intronic
1119335545 14:73830574-73830596 CTAAATATACAAAATTAGCTGGG - Intergenic
1119455171 14:74748990-74749012 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1119466805 14:74864678-74864700 CCAAAAGTACAAAATTAGCTGGG + Intronic
1119713582 14:76841871-76841893 CTAAAAGTACAAAATTAGCTGGG - Intronic
1119796387 14:77401535-77401557 AAAAATATAAAAAATCAGCTGGG + Intronic
1120051022 14:79866368-79866390 CAAAAAGTACAAACTAAGTTGGG + Intronic
1120193492 14:81460331-81460353 CAAAAAGTAAAAAATTAGCTGGG - Intergenic
1120604018 14:86549497-86549519 AAAAATGTAAAATATCAGCTGGG - Intergenic
1120860413 14:89250269-89250291 CAAAATTTAAAAAATTAGCTGGG - Intronic
1120916419 14:89714589-89714611 AAAAATGTAAAAACTTAGCTGGG + Intergenic
1121111231 14:91314507-91314529 CAAAGTGTTCACAGTCAGCTGGG - Intronic
1121156913 14:91694281-91694303 CAAAAAATACAAAATTAGCTGGG + Intronic
1121652289 14:95567624-95567646 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1122141428 14:99665204-99665226 AAAAATGGACAATTTCGGCTGGG - Intronic
1122457021 14:101862071-101862093 AAAAATTTAAAAAATCAGCTGGG - Intronic
1122908082 14:104811778-104811800 CAAAAAGTAAAAAATTAGCTGGG + Intergenic
1123188522 14:106544064-106544086 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1123727520 15:23119156-23119178 CAAAAAATACAAAATTAGCTGGG + Intergenic
1124135142 15:27028643-27028665 AAAAATATAAAAAATCAGCTGGG + Intronic
1124292272 15:28463925-28463947 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1124531460 15:30511584-30511606 CAAAAAATACAAAATTAGCTGGG + Intergenic
1124574563 15:30896335-30896357 AAAAAAGTACAAAATTAGCTGGG + Intergenic
1124767197 15:32496112-32496134 CAAAAAATACAAAATTAGCTGGG - Intergenic
1125133021 15:36306337-36306359 CTAAAAATACAAAATCAGCTGGG - Intergenic
1125165273 15:36696699-36696721 AAAAATCTTCCAATTCAGCTGGG - Intronic
1125494265 15:40176107-40176129 CAAAATTTAAAACTTTAGCTGGG - Intronic
1125547567 15:40517855-40517877 CTAAAAATACAAAATCAGCTGGG + Intergenic
1125559742 15:40619560-40619582 AAAAATGAACAAAATTAGCTAGG - Intronic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1125808786 15:42518578-42518600 CAAAAGATACAAAATTAGCTGGG - Intronic
1125910713 15:43436150-43436172 CAAAAAGTACAAAATTAGCCAGG - Intronic
1125977253 15:43965740-43965762 CTAAAAGTACAAAATTAGCTGGG - Intronic
1126414488 15:48403892-48403914 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1126604099 15:50458310-50458332 CTAAATATACAAAATTAGCTGGG - Intronic
1126679451 15:51189236-51189258 CAAAAAATACAAAATTAGCTGGG + Intergenic
1126717425 15:51534038-51534060 CCAAATGTACAAATACAGAATGG + Intronic
1126779981 15:52131119-52131141 TAAAATGCACACACTCAGCTGGG - Intronic
1126810089 15:52393552-52393574 AAAAATATAAAAATTTAGCTGGG - Intronic
1126879949 15:53083698-53083720 AATAATGTCCAAATTCTGCTTGG - Intergenic
1127007390 15:54585523-54585545 CAAAATGGACTAATACAGATGGG + Intronic
1127069995 15:55279517-55279539 AAAAATGTACAACTACAGTTAGG + Intronic
1127087361 15:55436979-55437001 CTAAAAGTACAAAATTAGCTGGG - Intronic
1127159459 15:56166061-56166083 CAAAAAATAAAAAATCAGCTGGG - Intronic
1127168365 15:56271843-56271865 AAAAATGTACAATTTAGGCTGGG + Intronic
1127492038 15:59473993-59474015 CATAATTTCCAACTTCAGCTGGG + Intronic
1127592481 15:60439540-60439562 TAAAATGTAAAAAATTAGCTGGG - Intronic
1127894958 15:63289841-63289863 AAAAATTAAAAAATTCAGCTGGG + Intronic
1128062599 15:64744395-64744417 CTAAAAATACAAAATCAGCTGGG + Intronic
1128102213 15:65011655-65011677 CAAAAAGTAAAAAATTAGCTGGG - Intronic
1128277184 15:66363479-66363501 TAAAATGTAAAAAATTAGCTGGG + Intronic
1128424390 15:67524995-67525017 CAAAAAATACAAAATTAGCTGGG - Intronic
1128590860 15:68895587-68895609 CAAAAAATACAAAATTAGCTGGG - Intronic
1128890534 15:71327896-71327918 CAGAATGTATTAATTCAGCCGGG + Intronic
1128898280 15:71395578-71395600 CAAAAAATACAAAATTAGCTGGG + Intronic
1128990092 15:72252644-72252666 CTAAAAATACAAAATCAGCTGGG - Intronic
1129245337 15:74275828-74275850 CTAAATATACAAAATTAGCTGGG - Intronic
1129537050 15:76322243-76322265 CAAAAAATACAAAATTAGCTGGG + Intergenic
1129763285 15:78144531-78144553 CAAAATATAAAAATTTAGCCAGG - Intronic
1130165703 15:81455708-81455730 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1130338300 15:82976835-82976857 CTAAAAGTACAAAATCAGCCAGG - Intronic
1130357026 15:83143171-83143193 CAAAAAATACAAAATTAGCTGGG - Intronic
1130602801 15:85288569-85288591 AAAAATTTAAAAAATCAGCTGGG - Intergenic
1130635332 15:85613518-85613540 AAAAATGTAGAAAATTAGCTGGG + Intronic
1130957062 15:88634772-88634794 AAAAATGTAAAAAATCAGCCAGG - Intergenic
1130958523 15:88644370-88644392 CTAAATATACAAAATTAGCTGGG + Intronic
1131093533 15:89641638-89641660 CTAAAAATACAAAATCAGCTGGG + Intronic
1131146248 15:90015050-90015072 CTAAAAGTACAAAATTAGCTGGG - Intronic
1131211777 15:90503819-90503841 AAAAATGCAAAAAATCAGCTGGG + Intergenic
1131290713 15:91104551-91104573 CAAAATGTACAGATACAGGGAGG + Intronic
1132090000 15:98940562-98940584 AAAAATATAAAAAATCAGCTGGG - Intronic
1132158120 15:99511054-99511076 TAAAAATTACAAATTCAGTTTGG + Intergenic
1132344000 15:101096563-101096585 CAAAATGTTCACAATCAGGTGGG - Intergenic
1132503268 16:294010-294032 CTAAATATACAAAATTAGCTGGG + Intronic
1132610294 16:812621-812643 CTAAAAGTACAAAATCAGCTGGG + Intronic
1132716926 16:1295410-1295432 CTAAAAATACAAAATCAGCTGGG - Intergenic
1132740043 16:1407533-1407555 AAAAATACAAAAATTCAGCTGGG + Intronic
1132918317 16:2367282-2367304 CAAAAAATACAAAATTAGCTGGG + Intergenic
1132990520 16:2790409-2790431 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1133116749 16:3581880-3581902 TAAAATATAAAAAATCAGCTGGG + Exonic
1133414739 16:5597559-5597581 CTAAAAGTACAAAATCAGCCAGG - Intergenic
1133589157 16:7226002-7226024 CAGAGTGTACAGATTCAGCAAGG - Intronic
1133725771 16:8536062-8536084 CTAAAAATACAAAATCAGCTGGG + Intergenic
1133772851 16:8877750-8877772 CAAAATACACAAATTTAGCCAGG + Intergenic
1133862168 16:9606163-9606185 AAAAATATAAAAAATCAGCTGGG - Intergenic
1134281915 16:12824673-12824695 CTAAAAATACAAATTTAGCTGGG - Intergenic
1134330838 16:13249890-13249912 AAAAATTTAAAAATTTAGCTGGG - Intergenic
1134506869 16:14814921-14814943 CTAAATATACAAAATTAGCTGGG - Intronic
1134563097 16:15227602-15227624 CTAAAAATACAAAATCAGCTGGG - Intergenic
1134573691 16:15313900-15313922 CTAAATATACAAAATTAGCTGGG + Intergenic
1134582693 16:15384497-15384519 AAAAATGCAAAAATTAAGCTGGG - Intergenic
1134630925 16:15755627-15755649 CATAATTTAAAAATTTAGCTGGG + Intronic
1135037098 16:19087358-19087380 TAAAATTTAAAAAATCAGCTGGG - Intergenic
1135391486 16:22097124-22097146 AAAAATACACAAAATCAGCTGGG - Intronic
1135432788 16:22400818-22400840 CAAAAAATAAAAATTAAGCTGGG - Intronic
1135571531 16:23552973-23552995 AAAAATATAAAAATTTAGCTGGG + Intronic
1135746517 16:25021583-25021605 CAAAATTTAAAAAATTAGCTGGG + Intergenic
1135807126 16:25552870-25552892 CAAAAAGTAAAAAATTAGCTGGG + Intergenic
1135958482 16:26976387-26976409 CTAAAAATACAAATTTAGCTGGG + Intergenic
1136067184 16:27767149-27767171 CGAAAGGTAGCAATTCAGCTAGG + Intronic
1136157230 16:28391340-28391362 CTAAAAGTACAAAATCAGCCAGG + Intronic
1136205856 16:28723941-28723963 CTAAAAGTACAAAATCAGCCAGG - Intronic
1136423820 16:30155156-30155178 AAAAATAAACAAAATCAGCTGGG + Intergenic
1136425065 16:30164511-30164533 AAAAATATACAAAATTAGCTGGG - Intergenic
1136474098 16:30501414-30501436 AAAAATGTACAAAATTAGCTGGG + Intronic
1136570102 16:31091589-31091611 AAAAATTTAGAAATTCAGCTGGG + Intronic
1136647732 16:31636562-31636584 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1136688463 16:32010046-32010068 CTAAATATACAAAATTAGCTGGG + Intergenic
1136717717 16:32297689-32297711 AAAAATATACAAAATTAGCTGGG - Intergenic
1136789058 16:32953585-32953607 CTAAATATACAAAATTAGCTGGG + Intergenic
1136836093 16:33503961-33503983 AAAAATATACAAAATTAGCTGGG - Intergenic
1136880754 16:33900349-33900371 CTAAATATACAAAATTAGCTGGG - Intergenic
1136926881 16:34382285-34382307 CTAAAAGTACAAAATGAGCTGGG - Intergenic
1136939245 16:34505301-34505323 CAGAATCTACAAATTCCTCTGGG + Intergenic
1136960574 16:34843260-34843282 CAGAATCTACAAATTCCTCTGGG - Intergenic
1136977693 16:35029522-35029544 CTAAAAGTACAAAATGAGCTGGG + Intergenic
1137084835 16:36106485-36106507 CAGAATCTACAAATTCCTCTGGG + Intergenic
1137219463 16:46432809-46432831 CAGAATCTACAAATTCCTCTGGG + Intergenic
1137271633 16:46906231-46906253 CAAAAAATACAAAATCAGCCAGG - Intronic
1137455181 16:48612474-48612496 CAAAATATAAAAAATTAGCTGGG + Intronic
1137496376 16:48972234-48972256 CAGAATGTACAACTTCATATTGG - Intergenic
1137743777 16:50805875-50805897 AAAAATGTAAAAAGCCAGCTGGG - Intergenic
1138386926 16:56642185-56642207 CAAAATGTACAAAGTAAGGGAGG + Intronic
1138576272 16:57909105-57909127 CAAAAAATACAAAATTAGCTAGG + Intronic
1138652262 16:58467344-58467366 CTAAAAATACAAAATCAGCTGGG + Intronic
1138666316 16:58572120-58572142 CTAAATATACAAAATTAGCTAGG + Intronic
1138704954 16:58905917-58905939 CAAAATGAATAATCTCAGCTGGG - Intergenic
1138770594 16:59658254-59658276 AAAAATTTAAAAATTTAGCTTGG + Intergenic
1138990828 16:62388882-62388904 AAAAATTTAAAAATTTAGCTGGG + Intergenic
1139200973 16:64976696-64976718 CTAAATATACAAAATTAGCTGGG + Intronic
1139457767 16:67096011-67096033 CAAAATGAGTTAATTCAGCTGGG + Intronic
1139518633 16:67466674-67466696 AAAAATAAACAAAATCAGCTGGG + Intronic
1139706740 16:68746262-68746284 AAAAATTCAAAAATTCAGCTGGG + Intronic
1139802154 16:69531647-69531669 AAAAATATAAAAATTCAGCCAGG - Intergenic
1139870338 16:70103430-70103452 TAAAAATTACAAAATCAGCTGGG + Intergenic
1139932498 16:70539935-70539957 CTAAAAGTACAAAATGAGCTGGG - Intronic
1140082770 16:71765177-71765199 CAAAATATACAAAATGAGCCGGG + Intronic
1140087922 16:71812744-71812766 TAAAATATACAAAATTAGCTGGG - Intergenic
1140377924 16:74460180-74460202 CTAAAAGTACAAAATTAGCTGGG - Intronic
1140385104 16:74529125-74529147 TAAAAATTACAAAATCAGCTGGG - Intronic
1140448529 16:75051366-75051388 AAAAATGTAAAAAATTAGCTGGG - Intronic
1140510058 16:75500655-75500677 CTAAAAATACAAATTTAGCTGGG - Intergenic
1140517202 16:75552156-75552178 CAAAAAACAAAAATTCAGCTGGG + Intronic
1140525097 16:75616167-75616189 CTAAATATACAAAATTAGCTGGG - Intronic
1140530834 16:75664462-75664484 CTAAAAGTACAAAATTAGCTAGG + Intronic
1140718957 16:77753079-77753101 CAAAATGCACAAAGCCAACTAGG - Intergenic
1140805537 16:78529112-78529134 AAAAATGAACAAACTTAGCTGGG - Intronic
1140817241 16:78632717-78632739 CTAAAAATACAAAATCAGCTGGG - Intronic
1140965417 16:79961660-79961682 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1141188068 16:81802730-81802752 CTAAAAATACAAAATCAGCTGGG - Intronic
1141335563 16:83151799-83151821 CTAAAAATACAAATTTAGCTGGG + Intronic
1141424967 16:83938952-83938974 CTAAAAGTACAAAATTAGCTGGG + Intronic
1141988195 16:87593633-87593655 CTAAAAATACAAAATCAGCTGGG + Intergenic
1142365757 16:89648728-89648750 AAAAATGAAAAAAATCAGCTGGG + Intronic
1142378478 16:89718872-89718894 AAAAATCTAAAAAATCAGCTGGG - Intronic
1203008711 16_KI270728v1_random:220075-220097 AAAAATATACAAAATTAGCTGGG + Intergenic
1203091260 16_KI270728v1_random:1215076-1215098 CTAAATATACAAAATTAGCTGGG + Intergenic
1203146270 16_KI270728v1_random:1804251-1804273 AAAAATATACAAAATTAGCTGGG - Intergenic
1142545091 17:695711-695733 CAAAAAGTACAAAATTAGCTGGG - Intronic
1142643217 17:1296670-1296692 CTAAAAATACAAAATCAGCTGGG - Intronic
1142745221 17:1953243-1953265 CAAAAAATACAAAATCAGCTGGG + Intronic
1142773855 17:2120430-2120452 AAAAGTATACAACTTCAGCTGGG + Intronic
1142778711 17:2163345-2163367 AAAAATTTAAAAAATCAGCTGGG - Intronic
1142835316 17:2581512-2581534 CTAAATATACAAAATCAGCTGGG + Intergenic
1143132653 17:4689863-4689885 TAAAATGTAAAAAATTAGCTAGG + Intronic
1143199915 17:5105359-5105381 AAAAATATAAAAAATCAGCTGGG + Intergenic
1143452758 17:7045595-7045617 AAAAATGAACAAATTTAGCCAGG - Intergenic
1143553063 17:7643330-7643352 CTAAAAATACAAAATCAGCTGGG - Intergenic
1143604771 17:7976480-7976502 CAAAATGCAAAAAATTAGCTGGG - Intergenic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1143753439 17:9048815-9048837 CTAAAAATACAAAATCAGCTGGG - Intronic
1144322386 17:14141376-14141398 CAAAATATACAAAATTAGCTAGG + Intronic
1144458970 17:15442247-15442269 CTAAATATACAAAATTAGCTGGG + Intronic
1144515420 17:15914355-15914377 AAAAATATAAAAAGTCAGCTGGG - Intergenic
1144531763 17:16045972-16045994 CAAAATATAAAAAATTAGCTGGG - Intronic
1145326763 17:21838013-21838035 CAGAATCTACAAATTCCTCTGGG - Intergenic
1145354466 17:22128804-22128826 CAAAATGCACAAACAAAGCTAGG + Intergenic
1145693598 17:26769462-26769484 CAGAATCTACAAATTCCTCTGGG - Intergenic
1145862062 17:28219124-28219146 CTAAATATACAAAATTAGCTGGG + Intergenic
1145891293 17:28417890-28417912 CAAAAATTACAAAATTAGCTGGG + Intergenic
1145929799 17:28677067-28677089 AAAAATGTAAAAAATTAGCTGGG + Intronic
1146031156 17:29367137-29367159 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1146084217 17:29812727-29812749 AAAAATATAAAAATTTAGCTGGG + Intronic
1146130168 17:30266362-30266384 CTAAAAATACAAAATCAGCTGGG + Intronic
1146333498 17:31949842-31949864 CTAAAAATACAAAATCAGCTGGG - Intronic
1146338630 17:31998238-31998260 AAAAATGCAAAAAATCAGCTGGG - Intronic
1147008130 17:37421217-37421239 CAAAAAGTAAAAATTTAGCCAGG + Intronic
1147268591 17:39250423-39250445 TAAAATATACAAAATTAGCTGGG + Intergenic
1147610158 17:41797237-41797259 CAAAATATAAAAAATTAGCTGGG - Intergenic
1147679578 17:42232624-42232646 CAAAATGTAGACACTCAGCCTGG + Intronic
1147681377 17:42249230-42249252 AAAAATATACAAAATTAGCTGGG + Intronic
1147797319 17:43053806-43053828 CTAAAAATACAAAATCAGCTGGG + Intronic
1147972695 17:44228154-44228176 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1147976715 17:44252214-44252236 CTAAAATTACAAAATCAGCTGGG - Intronic
1148389389 17:47259736-47259758 CTAAAAATACAAAATCAGCTGGG + Intronic
1148572400 17:48680629-48680651 CAAAAAATACAAAATTAGCTGGG + Intergenic
1148694530 17:49550985-49551007 CTAAACGTACAAAATTAGCTGGG - Intergenic
1148724854 17:49781679-49781701 CAAAATATAAAATTTCAGCCAGG + Intronic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149443648 17:56697067-56697089 CAAAAAATACAAAATTAGCTGGG - Intergenic
1149519465 17:57307583-57307605 TAAAAAGTACAAAATTAGCTGGG - Intronic
1149538000 17:57447397-57447419 TAAAATGTAAAACTTAAGCTGGG - Intronic
1149708806 17:58719887-58719909 AAAAATATAAAAAATCAGCTGGG - Intronic
1149797438 17:59533703-59533725 CAACAAATACAAATTTAGCTGGG - Intergenic
1150346476 17:64408331-64408353 CAAAACATACAAAATTAGCTGGG - Intronic
1150513924 17:65787320-65787342 AAAATTTTAAAAATTCAGCTGGG + Intronic
1150581019 17:66473771-66473793 CTAAAAATACAAAATCAGCTGGG + Intronic
1150727601 17:67664122-67664144 AAAAATGCAAAAATTTAGCTGGG - Intronic
1150736485 17:67744733-67744755 CAAAAAATACAAAATTAGCTGGG + Intergenic
1150952423 17:69818578-69818600 CCAAATGTACACATTCAGAGTGG + Intergenic
1151013387 17:70527110-70527132 CAAAATATAAAAAATAAGCTGGG + Intergenic
1151273791 17:73017550-73017572 CTAAAAATACAAATTTAGCTGGG + Intronic
1151491902 17:74436831-74436853 CTAAATGTTCAACTTCATCTTGG - Intronic
1151677256 17:75604974-75604996 CTAAAAATACAAAATCAGCTGGG + Intergenic
1151738446 17:75961606-75961628 CTAAATATACAAAATCAGCCAGG + Intronic
1151867855 17:76816233-76816255 CAAAAAATACAAAATCAGCTGGG + Intergenic
1151913913 17:77103600-77103622 TAAAATACACAAAATCAGCTGGG - Intronic
1152000571 17:77642800-77642822 CTAAAAATACAAAATCAGCTGGG - Intergenic
1152149802 17:78591898-78591920 CAAAAAATACAAAATTAGCTGGG - Intergenic
1152150348 17:78595899-78595921 CTAAAAGTACAAAATCAGCCGGG - Intergenic
1152262865 17:79276522-79276544 CTAAAAATACAAAATCAGCTGGG + Intronic
1152316307 17:79582634-79582656 CAAAAAATACAAAATTAGCTAGG + Intergenic
1152762702 17:82117475-82117497 CAAAATGTAAAAAATTAGCCAGG + Intronic
1152843782 17:82586738-82586760 CTAAAAATACAAAATCAGCTGGG + Intronic
1153116993 18:1670368-1670390 TAAAATGGACAGATTCATCTTGG + Intergenic
1153147962 18:2055371-2055393 AACAAGGTAGAAATTCAGCTAGG + Intergenic
1153310417 18:3672414-3672436 CTAAAAATACAAAATCAGCTGGG + Intronic
1153528427 18:6019434-6019456 CTAAAATTACAACTTCAGCTGGG - Intronic
1153585536 18:6616468-6616490 CTAAAAATACAAATTTAGCTGGG - Intergenic
1153744358 18:8162258-8162280 AAAAATGTAAAAAATTAGCTGGG - Intronic
1153867383 18:9285046-9285068 CAAAATGCAAAAAATCAGCCGGG + Exonic
1154149439 18:11894749-11894771 CTAAATATACAAAATTAGCTGGG - Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154286350 18:13060761-13060783 CAAAATTTTAAAAATCAGCTGGG + Intronic
1154336120 18:13466307-13466329 CAAAAAATACAAAATTAGCTGGG + Intronic
1154516256 18:15169163-15169185 CAGAATCTACAAATTCCTCTGGG + Intergenic
1155336310 18:24768917-24768939 AAAAATATAAAAATTTAGCTGGG - Intergenic
1155347407 18:24872216-24872238 CCAAATGTAACAATTTAGCTGGG - Intergenic
1155473731 18:26217047-26217069 CAAAATGCATAACCTCAGCTGGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1155926415 18:31660117-31660139 CAAAAAATACAAAATTAGCTGGG - Intronic
1156301451 18:35840068-35840090 AAAAATGTATAAATTCAACAGGG + Intergenic
1157165088 18:45351513-45351535 AAAAATGAACAAAATTAGCTGGG - Intronic
1157507855 18:48243101-48243123 AAAAATGTAAAAAATTAGCTGGG + Intronic
1157831084 18:50857634-50857656 CACAATCTCCAACTTCAGCTGGG + Intergenic
1158035612 18:53026011-53026033 GAAAATGTTCCAATTCAGCTTGG + Intronic
1158238868 18:55353899-55353921 CAAAATGGGCAAATTCATCCTGG + Intronic
1158271578 18:55722048-55722070 GAAAATGCTCAAACTCAGCTGGG - Intergenic
1158319272 18:56245374-56245396 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1158615949 18:58987259-58987281 AAAAATATAAAAAATCAGCTGGG + Intergenic
1158631654 18:59120502-59120524 CAAAATTTACAAATTAAGGAAGG - Intergenic
1158757096 18:60338384-60338406 CTAAATCTAGAAATTCATCTGGG + Intergenic
1159186938 18:64987179-64987201 CAAAATGTAAAAAATTAGCTGGG - Intergenic
1159401082 18:67935165-67935187 CAAAATGTAAAAAATAAGTTTGG - Intergenic
1159439593 18:68460239-68460261 CTAAATATACAAAATTAGCTGGG + Intergenic
1159510349 18:69390588-69390610 CAAAAAATACAAAATTAGCTAGG - Intergenic
1159636897 18:70815682-70815704 CTAAATATACAAAATTAGCTGGG + Intergenic
1159862251 18:73663094-73663116 CAAAAAATACAAAATTAGCTGGG - Intergenic
1160758029 19:768054-768076 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1160821396 19:1060370-1060392 CTAAAAATACAAAATCAGCTGGG - Intronic
1160866083 19:1256672-1256694 CAAAAATTACAAAATTAGCTGGG - Intronic
1160892251 19:1385351-1385373 CTAAAAATACAAAATCAGCTGGG + Intronic
1160948633 19:1655159-1655181 CAAAAAATACAAAATTAGCTGGG - Intergenic
1161547017 19:4887461-4887483 CTAAAAGTACAAAATTAGCTAGG + Intergenic
1161863655 19:6818113-6818135 CAAAAAATAAAAAGTCAGCTGGG - Intronic
1162010308 19:7809389-7809411 CAAAAAATACAAAATTAGCTGGG + Intergenic
1162162978 19:8732501-8732523 AAAAATGAACAAAATTAGCTGGG - Intergenic
1162280327 19:9691651-9691673 CAAAAAATAAAAATTTAGCTGGG - Intronic
1162302685 19:9852981-9853003 GAAAATGGAAAAATTCAGCTGGG + Intergenic
1162403945 19:10462313-10462335 CTAAAAGTACAAAATTAGCTGGG - Intronic
1162513338 19:11133034-11133056 CAAAAAGTTAAAAATCAGCTGGG + Intronic
1162755555 19:12857242-12857264 CTAAAAATACAAAATCAGCTGGG - Intronic
1162825575 19:13249514-13249536 CAAAAAGTACAAAATTAGCCTGG - Intronic
1162854442 19:13457690-13457712 AAAAAAGTACAAAATTAGCTGGG + Intronic
1162961427 19:14129515-14129537 AAAAATATAAAAATTTAGCTGGG + Intronic
1162994769 19:14327309-14327331 AAAAATGTAAAAATTTAGCCAGG + Intergenic
1163016524 19:14458836-14458858 CTAAAAGTACAAAATTAGCTGGG + Intronic
1163067325 19:14807733-14807755 AAAAATACAAAAATTCAGCTGGG + Intronic
1163273800 19:16269959-16269981 CTAAATATACAAAATTAGCTGGG - Intergenic
1163625132 19:18385135-18385157 CTAAATATACAAAATTAGCTGGG - Intronic
1163812110 19:19439684-19439706 CTAAAAGTACAAAATTAGCTGGG + Intronic
1163924223 19:20323391-20323413 CTAAAAATACAAAATCAGCTGGG - Intergenic
1163964319 19:20730322-20730344 CAAAAAATACAAAATTAGCTCGG - Intronic
1163969137 19:20775580-20775602 CACAATGTAAAAAATTAGCTGGG - Intronic
1164026918 19:21360973-21360995 CTAAAAATACAAAATCAGCTGGG - Intronic
1164031509 19:21410951-21410973 CAAAAAATACAAAATTAGCTGGG - Intronic
1164035913 19:21454784-21454806 AAAAATATAAAAAATCAGCTGGG + Intronic
1164065898 19:21716711-21716733 CTAAATATACAAAATTAGCTCGG + Intergenic
1164239883 19:23376548-23376570 CAAAAAATACAAAATTAGCTGGG - Intronic
1164614937 19:29661656-29661678 CAAAATTTAAAAAGTTAGCTGGG + Intergenic
1164641228 19:29827467-29827489 CTAAAAATACAAAATCAGCTGGG - Intergenic
1164732604 19:30517624-30517646 AAAAATTTACAAAATTAGCTGGG + Intronic
1164993623 19:32703160-32703182 CTAAAAATACAAAATCAGCTGGG - Intronic
1165347292 19:35256995-35257017 AAAAATGTAAAAAATTAGCTAGG - Intronic
1165797465 19:38527347-38527369 CTAAAAGTACAAAATTAGCTGGG + Intronic
1165960875 19:39533252-39533274 CAAAAAATAAAAAATCAGCTGGG - Intergenic
1166086979 19:40482798-40482820 CAAAATATACAAAATTAGCCGGG + Intronic
1166153907 19:40896313-40896335 CTAAAAATACAAAATCAGCTGGG - Intronic
1166222234 19:41373097-41373119 AAAAATAAACAAAATCAGCTGGG - Intronic
1166665586 19:44678279-44678301 CAAAAAGTAAAAAATAAGCTAGG - Intronic
1166697420 19:44860350-44860372 CAAAAAATACAAAATTAGCTGGG + Intronic
1166713605 19:44952580-44952602 CTAAAAGTACAAAATTAGCTGGG - Intronic
1167034600 19:46987374-46987396 CTAAAAATACAAAATCAGCTGGG - Intronic
1167136140 19:47616987-47617009 CAAAATATACAAAATTAGCTGGG - Intronic
1167164876 19:47791909-47791931 CTAAAAATACAAAATCAGCTGGG - Intergenic
1167174694 19:47857751-47857773 CTAAATATACAAAATTAGCTGGG - Intergenic
1167394961 19:49222507-49222529 CAAAATGTAAAAAATTAGTTGGG - Intergenic
1167563235 19:50239178-50239200 CTAAAAATACAAAATCAGCTGGG - Intronic
1167585431 19:50372323-50372345 AAAAATGTAAAAACTTAGCTGGG + Intronic
1167857213 19:52252307-52252329 CAAGACCTACAAATTCAGATGGG + Intergenic
1168022036 19:53616089-53616111 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1168041154 19:53759742-53759764 AAAAAAGTAAAAAATCAGCTGGG + Intergenic
1168345041 19:55646328-55646350 CTAAAGGTACAAAATTAGCTGGG - Intronic
1168367474 19:55801016-55801038 CTAAATATACAAAATTAGCTGGG + Intronic
1202669183 1_KI270709v1_random:35056-35078 CAGAATCTACAAATTCCTCTGGG - Intergenic
925130541 2:1491007-1491029 AAAAATATAAAAAATCAGCTGGG + Intronic
925236666 2:2284862-2284884 TAAAATATAAAAAATCAGCTGGG - Intronic
925819009 2:7780690-7780712 AAAAGTGTACAAAGTCAGCAGGG + Intergenic
925850966 2:8081704-8081726 AAAAAAATACAAAATCAGCTGGG + Intergenic
926108106 2:10165110-10165132 CAAAATATAAAAAATCAGCTAGG - Intronic
926166952 2:10527127-10527149 CTAAAAGTACAAAATTAGCTGGG - Intergenic
926273710 2:11387625-11387647 TAAAAAATACAAAATCAGCTGGG - Intergenic
926505167 2:13705226-13705248 CAAAAAGAAAAAATTCACCTAGG - Intergenic
926514758 2:13828902-13828924 CAGAATGTATAAAATCTGCTTGG - Intergenic
926596073 2:14791014-14791036 CTAAAAATACAAAATCAGCTGGG - Intergenic
926769739 2:16359444-16359466 CTAAAAATACAAAATCAGCTAGG - Intergenic
926778583 2:16446494-16446516 CTAAAAATACAAAATCAGCTGGG - Intergenic
926822036 2:16862969-16862991 CTAAAAATACAAAATCAGCTGGG - Intergenic
926999174 2:18774341-18774363 CTAAAAATACAAAATCAGCTGGG + Intergenic
927121204 2:19965082-19965104 CTAAATATACAAAATTAGCTGGG - Intronic
927539396 2:23894318-23894340 CAAAAAATACAAAATTAGCTGGG + Intronic
927705242 2:25292769-25292791 CAAAATGTACAAAATTCTCTAGG + Intronic
928014223 2:27639682-27639704 CAAAATATAAAAAATTAGCTGGG - Intronic
928076546 2:28270280-28270302 CAAAAAATAAAAAATCAGCTAGG - Intronic
928510499 2:31998637-31998659 AAAAATACAAAAATTCAGCTGGG + Intronic
928568460 2:32578633-32578655 AAAAATACAAAAATTCAGCTGGG + Intronic
928651928 2:33412760-33412782 CAAAATATACAAAATTAGCCAGG - Intergenic
928654678 2:33438399-33438421 CTAAATATACAAAATTAGCTGGG + Intronic
929157235 2:38799204-38799226 CTAAAAGTACAAAATTAGCTGGG + Intronic
929225061 2:39504020-39504042 CTAAAAATACAAAATCAGCTGGG + Intergenic
929352870 2:40981506-40981528 AAAAAATTACAAAATCAGCTGGG + Intergenic
929370783 2:41221943-41221965 CTAAATATACAAAATTAGCTGGG + Intergenic
929410953 2:41696946-41696968 CAAAAAGCTCACATTCAGCTGGG - Intergenic
929553564 2:42909464-42909486 CTAAAAGTACAAAATTAGCTGGG + Intergenic
929614146 2:43295095-43295117 CAAAAAATAAAAAGTCAGCTGGG + Intronic
929640594 2:43575287-43575309 AAAAATTTAAAAATTTAGCTGGG + Intronic
929910167 2:46083110-46083132 CAAAAAATACAAAATTAGCTGGG - Intronic
930060603 2:47285308-47285330 CTAAATATAAAAATTTAGCTGGG + Intergenic
930118547 2:47740852-47740874 AAAAATGAAAAAATTCAGCTGGG - Intronic
930192615 2:48475684-48475706 CTAAAAATACAAAATCAGCTGGG + Intronic
930342657 2:50136282-50136304 CAAATTGTTCAAAATGAGCTGGG + Intronic
930351966 2:50268027-50268049 CAAAATACAAAAAATCAGCTGGG + Intronic
930436302 2:51348019-51348041 AAAAATGTAAAAATTTAGCCTGG + Intergenic
930751188 2:54935867-54935889 CAAAATTTAAAAAATTAGCTGGG + Intronic
930822151 2:55657546-55657568 CTAAAAGTACAAAATTAGCTGGG - Intronic
930932373 2:56902518-56902540 CTAAAAGTACAAAATTAGCTGGG + Intergenic
930971458 2:57399505-57399527 CTAAAAGTACAAAATTAGCTGGG - Intergenic
931325086 2:61213174-61213196 CAAAAAATACAAAATTAGCTGGG - Intronic
931533261 2:63241755-63241777 CAAAAATTAAAAATTTAGCTGGG - Intronic
931557063 2:63518047-63518069 CTAAAAGTACAAAATTAGCTGGG - Intronic
931727201 2:65122808-65122830 AAAAATGCAAAAATTTAGCTGGG + Intronic
931805603 2:65800754-65800776 CAAAAAATTCAAAATCAGCTGGG - Intergenic
931930449 2:67127775-67127797 CTAAAAGTACAAAATTAGCTGGG + Intergenic
931961170 2:67485019-67485041 AAAAATGAAGAAATTTAGCTGGG + Intergenic
932107946 2:68965292-68965314 CAAAAAATACAAAATTAGCTGGG + Intergenic
932195048 2:69776133-69776155 AAAAATATAAAAATTAAGCTGGG - Intronic
932266173 2:70368680-70368702 CAAAAAATACAAAATGAGCTGGG + Intergenic
932382398 2:71297118-71297140 CAAAAAATACAAAATTAGCTGGG + Intronic
932603908 2:73150824-73150846 AAAAATGTACAAAATTGGCTGGG - Intronic
932724992 2:74171740-74171762 TAAAATGTAAAAAATTAGCTGGG + Intronic
932895634 2:75636900-75636922 CAAAAAATACAAAATTAGCTGGG + Intergenic
933076246 2:77931050-77931072 AAACATTTAAAAATTCAGCTGGG + Intergenic
933270024 2:80223433-80223455 CTAAATATACAAAATTAGCTGGG - Intronic
933311722 2:80669047-80669069 CAAAAAATACAAAATTAGCTGGG - Intergenic
933409624 2:81909427-81909449 AAAAATGTAAAAAATTAGCTGGG - Intergenic
933815478 2:86064934-86064956 CTAAAAGTACAAAATTAGCTGGG - Intronic
934076847 2:88435779-88435801 CTAAAAGTACAAAATTAGCTGGG - Intergenic
934084683 2:88500284-88500306 CTAAAAATACAAAATCAGCTGGG - Intergenic
934175672 2:89578336-89578358 TAAAAAATACAAAATCAGCTGGG + Intergenic
934252112 2:90364809-90364831 CAGAATCTACAAATTCCTCTGGG + Intergenic
934257331 2:91438137-91438159 CAGAATCTACAAATTCCTCTGGG - Intergenic
934285988 2:91652701-91652723 TAAAAAATACAAAATCAGCTGGG + Intergenic
934330970 2:92068713-92068735 CAGAATCTACAAATTCCTCTGGG - Intergenic
934575451 2:95397756-95397778 CAAAATGTAGAAATTTAGCCAGG + Intergenic
934700538 2:96436349-96436371 CTAAAAGTACAAAATTAGCTGGG - Intergenic
935044038 2:99463356-99463378 CTAAAAATACAAAATCAGCTGGG + Intronic
935117071 2:100145876-100145898 CAAAAAATAAAAAATCAGCTGGG + Intergenic
935154045 2:100466382-100466404 CTAAATATACAAAATTAGCTGGG - Intergenic
935216560 2:100979689-100979711 CAAAAAATACAAAATTAGCTGGG - Intronic
935468331 2:103426128-103426150 CAAAATGTATAATTTAGGCTGGG + Intergenic
935688261 2:105705966-105705988 CTAAAAATACAAAATCAGCTGGG + Intergenic
936400164 2:112158732-112158754 AAAAATTTAAAAATTCAGCCAGG - Intronic
936401785 2:112170079-112170101 AAAAATGTAAAAAGTTAGCTGGG + Intronic
936436754 2:112514219-112514241 CAAAATATGCAAAATTAGCTGGG + Intronic
936635756 2:114255475-114255497 CAAAATATACAAAATGAGCCTGG - Intergenic
936675899 2:114713693-114713715 CTAAAAGTACAAATTTGGCTGGG + Intronic
936719664 2:115235720-115235742 CTAAATATACAAAATTAGCTGGG - Intronic
936821425 2:116526953-116526975 TAAAATGTTTAAATTCAGTTTGG - Intergenic
937418716 2:121737620-121737642 CTAAACATACAAATTAAGCTGGG - Intronic
937446025 2:121958593-121958615 AAAAAAGTAAAAATTCAGTTTGG - Intergenic
937602738 2:123758601-123758623 AAAGATTTACAAATTCGGCTAGG - Intergenic
938016051 2:127868033-127868055 CAAAAAATACAAATTCAGCTGGG - Intronic
938300235 2:130205613-130205635 AAAAATGTAAAAATGCGGCTGGG - Intergenic
938456487 2:131468882-131468904 AAAAATGTAAAAATGCGGCTGGG + Intronic
938516588 2:132014168-132014190 CAGAATCTACAAATTCCTCTGGG + Intergenic
938783369 2:134605016-134605038 CTAAATATACAAAATTAGCTGGG + Intronic
938891530 2:135710454-135710476 CTAAAAATACAAAATCAGCTGGG + Intronic
938896783 2:135759927-135759949 CTAAAAATACAAAATCAGCTGGG - Intronic
939228169 2:139389709-139389731 CAAAATGTACAAATAGATGTTGG - Intergenic
939355663 2:141098816-141098838 CTAAAAATACAAAATCAGCTGGG - Intronic
939380106 2:141424272-141424294 CTAAAAGTACAAAATTAGCTGGG - Intronic
939577060 2:143908673-143908695 CTAAAAATACAAAATCAGCTGGG + Intergenic
939687668 2:145219594-145219616 TAAAATGTCCAAATACATCTTGG - Intergenic
939803227 2:146738954-146738976 CAAAAAAGAAAAATTCAGCTGGG - Intergenic
939880350 2:147624066-147624088 CAAAATAAAAAATTTCAGCTGGG - Intergenic
939970395 2:148652299-148652321 CTAAGTATACAAATTCACCTTGG - Intronic
940378764 2:152988971-152988993 CCAAATCTGAAAATTCAGCTAGG - Intergenic
940690959 2:156920308-156920330 TAAAATGTACAATTTGAGTTTGG + Intergenic
940866927 2:158826390-158826412 CAACAGGAACAAGTTCAGCTGGG + Intronic
940879032 2:158927740-158927762 CAAAAAATACAAAATTAGCTGGG - Intergenic
940957377 2:159743197-159743219 CAAACTGTACTACCTCAGCTGGG + Exonic
941521682 2:166552881-166552903 CTAAATATACAAAATGAGCTGGG + Intergenic
941789373 2:169534618-169534640 CTAAATATACAAAATTAGCTGGG - Intronic
941791981 2:169562391-169562413 CAAAAAATACAAAATTAGCTGGG - Intronic
941936964 2:170989724-170989746 CAAAAAGTACAAAAGTAGCTGGG + Intergenic
942024435 2:171898403-171898425 CAAAAATTAAAAATTTAGCTGGG - Intronic
942098140 2:172553295-172553317 AAAAATGAACAAAATTAGCTGGG - Intergenic
942297631 2:174533150-174533172 CAAAATATAAAAATACACCTTGG + Intergenic
942647757 2:178132749-178132771 CTAAAAATACAAAATCAGCTGGG - Intronic
942699669 2:178691187-178691209 CAAAATGTACTATTTTAGTTAGG + Intronic
943048412 2:182886484-182886506 CTAAAAATACAAAATCAGCTGGG - Intergenic
943305418 2:186255560-186255582 CTAAAAATACAAAATCAGCTGGG + Intergenic
943418132 2:187634846-187634868 CAAAATATAAAAAATTAGCTGGG + Intergenic
943587774 2:189760628-189760650 TAAAATGCAAAAAATCAGCTGGG + Intronic
943599402 2:189896376-189896398 CAAAATGTACATTTTCCCCTAGG - Intronic
944063220 2:195591524-195591546 CTAAAAGTACAAAATTAGCTGGG - Intronic
944099366 2:196006151-196006173 AAAAATGAACAAAATTAGCTGGG + Intronic
944380805 2:199108398-199108420 CAAGATGTACAAATTAAGTGAGG - Intergenic
944449774 2:199830058-199830080 CAAAATCTAAAAATTAAACTGGG + Intronic
944653137 2:201851818-201851840 CTAAATATACAAAATTAGCTGGG - Intronic
944691256 2:202160472-202160494 AAAAATATAAAAAATCAGCTGGG - Intronic
944707415 2:202305161-202305183 TAAAGGGTACAAATACAGCTGGG - Intergenic
944752204 2:202721792-202721814 AAAAATGTAAAAAATTAGCTGGG - Intronic
944819914 2:203419825-203419847 CTAAAAGTACAAAATTAGCTGGG + Intronic
944886871 2:204072135-204072157 CAAAAAATACAAAATTAGCTGGG - Intergenic
945098423 2:206241235-206241257 AAAAATGTTAAAAATCAGCTGGG + Intergenic
945255596 2:207800510-207800532 CTAAAAGTACAAAATTAGCTGGG + Intergenic
945707546 2:213254569-213254591 TAAAATGTACAAAATTAGCGGGG - Intergenic
945923860 2:215783505-215783527 AGAAATGTGCAAATTCGGCTGGG + Intergenic
946282303 2:218674759-218674781 CTAAAAGTACAAAATTAGCTAGG - Intronic
946400023 2:219463572-219463594 CAAAAAATACAAAATTAGCTGGG - Intronic
946566267 2:220969188-220969210 CTAAAAATACAAAATCAGCTGGG + Intergenic
946799184 2:223392073-223392095 CTAAATATACAAAATCAGCTGGG - Intergenic
946832787 2:223742923-223742945 CTAAAAATACAAATTTAGCTGGG - Intergenic
947233973 2:227920839-227920861 CTAAAAATACAAATTTAGCTTGG - Intronic
947566110 2:231194540-231194562 CTAAAAATACAAAATCAGCTGGG + Intergenic
947852165 2:233297117-233297139 CAAAATATAAAAAATTAGCTGGG - Intergenic
947969972 2:234315232-234315254 CAAAATATAAAAAATTAGCTGGG - Intergenic
948072195 2:235136840-235136862 CAAAAGTTAAAACTTCAGCTGGG + Intergenic
948172436 2:235915517-235915539 AAAAATGCAAAAATTTAGCTGGG + Intronic
948249438 2:236513834-236513856 CAATATGTATGAATTCAGTTGGG + Intergenic
1168881662 20:1211432-1211454 CTAAAAATACAAAATCAGCTGGG - Intergenic
1169070024 20:2720255-2720277 AAAAATACAAAAATTCAGCTGGG - Intronic
1169137842 20:3208534-3208556 CAAAAAGTACAAAATTAGCTGGG - Intergenic
1169495348 20:6109738-6109760 AAAAAAATACAAATTTAGCTGGG + Intronic
1169644899 20:7799211-7799233 GAAAATCTACAAACTCACCTTGG + Intergenic
1169841773 20:9945716-9945738 AAAAATGTAAAAAATTAGCTGGG + Intergenic
1169887309 20:10414424-10414446 CTAAAAGTACAAAATTAGCTGGG - Intronic
1170005160 20:11660283-11660305 CATAAGTAACAAATTCAGCTAGG + Intergenic
1170142427 20:13138222-13138244 CAACATGTACTACTTCAGTTTGG - Intronic
1170203301 20:13768419-13768441 CTAAATATACAAAATTAGCTGGG + Intronic
1170239004 20:14141582-14141604 CAAAAAATACAAAATTAGCTGGG + Intronic
1170384909 20:15805635-15805657 CTAAATATACAAAATTAGCTGGG - Intronic
1170556120 20:17516164-17516186 CTAAAAGTACAAAATTAGCTGGG + Intronic
1170662299 20:18353791-18353813 CTAAAAATACAAAATCAGCTGGG + Intergenic
1170797126 20:19557800-19557822 GAAAGTGGACAAGTTCAGCTTGG - Intronic
1171257941 20:23705300-23705322 CTAAACGTACAAAATTAGCTGGG - Intergenic
1171969680 20:31556197-31556219 CTAAATATACAAAATCAGCCGGG - Intronic
1172035311 20:32006543-32006565 CTAAATATACAAAATTAGCTGGG - Intergenic
1172066833 20:32227357-32227379 AAAAATGTAAAAAATTAGCTGGG + Intronic
1172081761 20:32347090-32347112 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1172491110 20:35338682-35338704 CTAAATGTAAAAAATCAGCCTGG + Intronic
1172698783 20:36840021-36840043 AAAAATATAAAAAATCAGCTGGG - Intronic
1172743523 20:37188313-37188335 CAAAATACAAAAAATCAGCTGGG - Intronic
1173169246 20:40709994-40710016 AAAAATGTTAATATTCAGCTGGG - Intergenic
1173206209 20:40996094-40996116 CTAAATATAAAAATTTAGCTGGG - Intergenic
1173275308 20:41575268-41575290 CAAAATGTACAAACAAAGCAAGG - Intronic
1173364476 20:42372442-42372464 GAAAATATACAAATTTAGCTAGG - Intronic
1173398731 20:42705042-42705064 CTAAAAATACAAAATCAGCTGGG + Intronic
1173532707 20:43782683-43782705 CTAAAAATACAAAATCAGCTGGG - Intergenic
1173728043 20:45310444-45310466 CAAAAAATACAAAATTAGCTGGG + Intronic
1174233874 20:49071643-49071665 CAAAATAAAAAAAATCAGCTGGG - Intronic
1174285879 20:49472995-49473017 CAAAATGGACTAATACAGATAGG + Intronic
1174337433 20:49873184-49873206 CAAAATCCACACATTTAGCTGGG + Intronic
1174520261 20:51123900-51123922 CAAAAAATACAAAATTAGCTGGG + Intergenic
1174573253 20:51518959-51518981 CAAAATGTTTAAACTTAGCTAGG - Intronic
1174623710 20:51896908-51896930 AAAAAGCTACAAACTCAGCTGGG - Intergenic
1174626125 20:51915933-51915955 AAAATTGTACAAAATCGGCTGGG + Intergenic
1174642829 20:52059918-52059940 CAAAATATAAAAATTTAGTTGGG + Intronic
1174690219 20:52496759-52496781 AAAAATATAAAAAATCAGCTGGG - Intergenic
1174801944 20:53571563-53571585 AAAAATACACAAATTTAGCTGGG - Intronic
1174942733 20:54948646-54948668 CAAAATGTAGAAATTCATCAAGG - Intergenic
1174953484 20:55068563-55068585 CAAAATGTAAAAATATAACTTGG + Intergenic
1175002516 20:55644644-55644666 CTAAAAATACAAAATCAGCTGGG - Intergenic
1175077758 20:56390466-56390488 CTAAAAATACAAAATCAGCTGGG - Intronic
1175085792 20:56457716-56457738 TAAAAGTTACAAATTTAGCTGGG + Intronic
1175215127 20:57388302-57388324 AAAAATTTAAAAAATCAGCTGGG + Intergenic
1175233743 20:57493859-57493881 AAAAATTTAAAAAATCAGCTGGG - Intergenic
1175437512 20:58964262-58964284 CTAAAAATACAAAATCAGCTGGG + Intergenic
1175849200 20:62079091-62079113 CAAAAAGTACAAAATGAGTTGGG + Intergenic
1176732861 21:10518111-10518133 AAAAATACAAAAATTCAGCTGGG + Intergenic
1177049520 21:16214835-16214857 AAAAAAATACAAAATCAGCTCGG - Intergenic
1177372584 21:20223044-20223066 TAAAAAGTACAAAATTAGCTGGG - Intergenic
1177796838 21:25787986-25788008 CAAAAAATACAAAATCAGCCGGG - Intergenic
1178359828 21:31939567-31939589 CTAAAAATACAAAATCAGCTGGG - Intronic
1178616726 21:34141066-34141088 GAAAAGGAACAAATTCAGCAAGG - Intronic
1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG + Intergenic
1178870640 21:36371972-36371994 CAAAAAATACAAAATTAGCTGGG - Intronic
1178988572 21:37331771-37331793 CAAAATTTAAAAATTCTTCTGGG - Intergenic
1179264448 21:39790495-39790517 CAAAAAGTACAAAATTAGCTGGG + Intronic
1179605202 21:42511622-42511644 CAAAATTTAAAAAATTAGCTGGG + Intronic
1179619671 21:42605047-42605069 AAAAATATACAAAATTAGCTGGG + Intergenic
1179664078 21:42897835-42897857 AAAAATGTAAAAAATTAGCTGGG - Intronic
1179768609 21:43595495-43595517 CAAAAAATACAAAAACAGCTGGG + Intronic
1179895871 21:44362932-44362954 TAAAATCTAAAAAATCAGCTGGG - Intronic
1180156490 21:45980000-45980022 CAAAACATACAAAATTAGCTGGG + Intergenic
1180605176 22:17053381-17053403 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1181125591 22:20700197-20700219 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1181297723 22:21854348-21854370 CAAAAAATACAAAATTAGCTGGG - Intronic
1181696969 22:24598274-24598296 CTAAAAGTACAAAATAAGCTGGG + Intronic
1181724273 22:24800695-24800717 CTAAAAATACAAAATCAGCTGGG - Intergenic
1181781482 22:25196729-25196751 TAAAAAGCTCAAATTCAGCTGGG - Exonic
1181994126 22:26861416-26861438 CCAAAAGTACAAAATCAGCCGGG + Intergenic
1182156808 22:28081651-28081673 CTAAATGTACAAAATTAGCTGGG - Intronic
1182330529 22:29548392-29548414 CAAAAAATACAAAATTAGCTGGG + Intronic
1182503156 22:30763344-30763366 CAAAATATACAAACACAGGTTGG + Intronic
1182543867 22:31061516-31061538 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1182625060 22:31639521-31639543 GAAAATATACACTTTCAGCTAGG - Intronic
1182644743 22:31799202-31799224 AAAAATATACAAAATTAGCTGGG - Intronic
1182661584 22:31929030-31929052 CAAAATGTTCATTTTCAGCAGGG - Intergenic
1182679196 22:32065102-32065124 AAAAATGTAAAAACTTAGCTGGG - Intronic
1183161981 22:36120506-36120528 AAAAATTAAAAAATTCAGCTGGG + Intergenic
1183209524 22:36442341-36442363 CTAAATATACAAAATTAGCTGGG + Intergenic
1183336570 22:37251126-37251148 CTAAATATACAAAATTAGCTGGG - Intergenic
1183890182 22:40920951-40920973 CTAAAAATACAAAATCAGCTGGG - Intronic
1184068232 22:42132344-42132366 CAAAAAATACAAAATTAGCTGGG - Intergenic
1184121770 22:42455380-42455402 AAAAATGTAAAAAATTAGCTGGG + Intergenic
1184763117 22:46556659-46556681 CAAAAAATACAAAATTAGCTGGG - Intergenic
1184819309 22:46897136-46897158 CAAAATGCACAAACAAAGCTAGG + Intronic
1185304816 22:50108981-50109003 CTAAAAGTACAAAATTAGCTGGG + Intronic
1203325463 22_KI270738v1_random:10292-10314 CAGAATCTACAAATTCCTCTGGG + Intergenic
949092151 3:40930-40952 CAAAAAGTACAAAATTAGCTAGG - Intergenic
949136025 3:566537-566559 CAAAATACACAAAATTAGCTGGG + Intergenic
949196161 3:1310838-1310860 CTAAAAATACAAAATCAGCTGGG + Intronic
949422660 3:3882618-3882640 CAAAAAATACAAAATTAGCTGGG + Intronic
949794520 3:7833595-7833617 CTAAATATACAAAATTAGCTGGG + Intergenic
950070866 3:10151284-10151306 CTAAATGTACAAATTCTTATAGG + Exonic
950074188 3:10175592-10175614 GAAAAGGTACAAAATCAGCTGGG + Intronic
950603787 3:14059514-14059536 CTAAAAGTACAAAATTAGCTGGG - Intronic
950759990 3:15214039-15214061 AAAAATATAAAAAATCAGCTGGG - Intronic
950774878 3:15340889-15340911 CTAAAAATACAAAATCAGCTGGG + Intronic
950972386 3:17202293-17202315 CAAAGTGTTCAAATGCAGCCTGG + Intronic
951217190 3:20036638-20036660 AAAAATATAAAAAATCAGCTGGG + Intergenic
951252414 3:20409545-20409567 CAAAAGGTAGAACTTCAGGTTGG - Intergenic
951353081 3:21630364-21630386 CTAAAAATACAAAATCAGCTGGG - Intronic
951551568 3:23880085-23880107 AAAAATGTAAAAATTAGGCTGGG + Intronic
951639701 3:24823045-24823067 CTAAAAGTACAAAATTAGCTGGG - Intergenic
951642468 3:24851264-24851286 CAAAATATAAAAAGTTAGCTGGG + Intergenic
951664264 3:25104481-25104503 GAAAATATAAAAATTTAGCTTGG + Intergenic
951779753 3:26349063-26349085 CTAAAATTACAAAATCAGCTGGG - Intergenic
951871435 3:27366969-27366991 CAAAAAATACAAAATTAGCTGGG - Intronic
951913093 3:27771629-27771651 CAAAAAATACAAAATTAGCTGGG + Intergenic
951915862 3:27800106-27800128 CTAAAAATACAAAATCAGCTGGG - Intergenic
952464381 3:33565649-33565671 CTAAAAATACAAATTTAGCTGGG + Intronic
952615471 3:35266869-35266891 GAAAATGTGCAAATTCAGGCAGG - Intergenic
952765517 3:36950510-36950532 AGAAATGTACAAGTTGAGCTTGG + Intergenic
953061480 3:39431601-39431623 CTAAAAATACAAATTTAGCTGGG - Intergenic
953114585 3:39979475-39979497 CTAAAAGTACAAAATGAGCTGGG + Intronic
953182670 3:40611128-40611150 CAAAAAATACAAAATTAGCTGGG - Intergenic
953312826 3:41896413-41896435 CTAAAAGTACAAAATTAGCTGGG - Intronic
953316784 3:41935385-41935407 AAAAAAATACAAATTTAGCTGGG - Intronic
953497091 3:43397088-43397110 CTAAAAATACAAAATCAGCTGGG - Intronic
953605992 3:44413649-44413671 CAAAAAATACAAAATTAGCTGGG - Intergenic
953686731 3:45083746-45083768 CAAAAAATACAAAATTAGCTGGG + Exonic
953717323 3:45326650-45326672 TAAAATGTAGCAATTCAGCTTGG + Intergenic
953730345 3:45441918-45441940 CAGAATGTAGAAATGCAGCTTGG + Intronic
953904198 3:46860287-46860309 CAAAAATTAAAAATTTAGCTTGG - Intronic
953935760 3:47040732-47040754 CAAAAAATACAAAATTAGCTTGG - Intronic
954064671 3:48096371-48096393 CAAAAAATACAAAATTAGCTGGG + Intergenic
954157840 3:48697005-48697027 AAAAAAGTAAAAATTCAGCTGGG - Intronic
954158126 3:48699247-48699269 CTAAAAATACAAAATCAGCTGGG + Intronic
954350096 3:50036053-50036075 AAAAATATAAAAATTGAGCTGGG - Intronic
954559715 3:51546477-51546499 CTAAAAGTACAAAATTAGCTGGG + Intronic
954562501 3:51569991-51570013 AAAAAACTACAAAATCAGCTGGG - Intronic
954844398 3:53542889-53542911 CTAAAAATACAAAATCAGCTGGG + Intronic
954908706 3:54085351-54085373 CAAAAAATACAAAATTAGCTGGG - Intergenic
955197222 3:56816052-56816074 CAAAATGTAAAAATTTAGGAGGG + Intronic
955232739 3:57113396-57113418 CTAAAAATACAAAATCAGCTGGG - Intronic
955700036 3:61672996-61673018 CAAAATATAAAAAATTAGCTGGG + Intronic
956202954 3:66726643-66726665 CTAAATATACAAAATTAGCTGGG + Intergenic
956449754 3:69362514-69362536 CTAAAAGTACAAAATTAGCTGGG + Intronic
956506300 3:69943928-69943950 AAAAATGTAAAAAATTAGCTGGG + Intronic
956599015 3:70999056-70999078 CAATATGTACAAATTCTGGTAGG + Intronic
956935409 3:74095333-74095355 CTAAAAATACAAAATCAGCTGGG + Intergenic
957004430 3:74927822-74927844 CAAAAAATACAAAATTAGCTGGG - Intergenic
957032407 3:75256884-75256906 CAAAAAGTACAAAATTAGCTAGG - Intergenic
957071296 3:75569957-75569979 CAAAAAATACAAAATTAGCTGGG - Intergenic
957127324 3:76178778-76178800 CTAAAAGTACAAAATTAGCTGGG + Intronic
957330354 3:78755311-78755333 CAAAATGTACAAAATTAGCTAGG + Intronic
957376245 3:79362676-79362698 CAAAAGGCAGAATTTCAGCTGGG - Intronic
957380415 3:79421004-79421026 CAAAATGTACATATACACCATGG + Intronic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
957566072 3:81885683-81885705 CAAAGTTTACAAATTCATATCGG - Intergenic
957619241 3:82573578-82573600 CAAAAAATACAAAATTAGCTGGG + Intergenic
958436936 3:94108519-94108541 CTAAAAGTACAAAAACAGCTGGG - Intronic
959057087 3:101577683-101577705 CTAAAAGTACAAATTAAGATGGG - Intronic
959223394 3:103551107-103551129 CAAAAAATACAAAATTAGCTGGG + Intergenic
959463174 3:106651402-106651424 AAAAATGTAAAAAATTAGCTGGG - Intergenic
959977973 3:112483307-112483329 CTAAAAATACAAAATCAGCTGGG - Intronic
960105306 3:113789206-113789228 CTAAAAATACAAAATCAGCTGGG - Intronic
960112092 3:113855148-113855170 CTAGAAGTACAAAATCAGCTGGG + Intronic
960638556 3:119807280-119807302 CACAGTGTACAAAGTCAGCATGG - Exonic
960657805 3:120025181-120025203 AAAAATATAAAAATTTAGCTGGG + Intronic
961010972 3:123435710-123435732 TAAGAAGTAAAAATTCAGCTGGG + Intronic
961151598 3:124642976-124642998 CTAAAAGTACAAAATTAGCTTGG - Intronic
961189404 3:124945403-124945425 CTAAAAATACAAAATCAGCTGGG - Intronic
961214146 3:125146798-125146820 AAAAATGTACAAACTTAGCTGGG - Intronic
961394150 3:126574690-126574712 CTAAAAATACAAAATCAGCTGGG + Intronic
961648696 3:128406650-128406672 AAAAATGCAAAAAATCAGCTAGG + Intronic
961679233 3:128587798-128587820 CAAAATACACAAGTTCAGCCAGG + Intergenic
961690463 3:128665872-128665894 CAAAAAATAAAAAATCAGCTGGG - Intronic
961690519 3:128666182-128666204 AAAAATGCAAAAAATCAGCTGGG - Intronic
962310090 3:134319642-134319664 CTAAAAGTACAAAATTAGCTGGG + Intergenic
962511384 3:136104465-136104487 CAAAAAATACAAAATTAGCTGGG - Intronic
962578635 3:136777247-136777269 AAAAATATAAAAAATCAGCTGGG + Intergenic
962744209 3:138385440-138385462 AAAAATTTACAAATAAAGCTGGG - Intronic
962783363 3:138742707-138742729 AAAAATGCGCAAATTCAGCGAGG - Exonic
963172249 3:142262746-142262768 TAAAAAGTACAAAATTAGCTGGG + Intergenic
963589017 3:147232846-147232868 CAAAATGTAAAATTTCAGAGGGG - Intergenic
964322970 3:155517144-155517166 AAAAATTTACAAAATTAGCTGGG + Intronic
964851789 3:161103886-161103908 CTAAATATACAAAATTAGCTGGG - Intronic
965116769 3:164500366-164500388 AAAAATATACAAAATTAGCTGGG + Intergenic
965225595 3:165984856-165984878 CATCTTGTACAAATTCAGTTTGG - Intergenic
965521761 3:169675061-169675083 CAAAAAATACAAAATTAGCTGGG - Intergenic
965578369 3:170241946-170241968 CTAAAAGTACAAAATTAGCTGGG + Intronic
965648993 3:170913676-170913698 AAAAATGTATAAAATCAGCAGGG - Intergenic
965785939 3:172334601-172334623 CTAAAAGTACAAAATTAGCTGGG - Intronic
965888448 3:173478623-173478645 CAAAATGTGAAAATTGGGCTGGG + Intronic
966415709 3:179687496-179687518 CTAAAAATACAAAATCAGCTGGG + Intronic
966648690 3:182274693-182274715 AAAAATTAACAAAATCAGCTGGG + Intergenic
966710083 3:182962939-182962961 CAAAAAATACAAAATTAGCTGGG - Intronic
966723139 3:183084759-183084781 AAAAATTTAAAAAATCAGCTGGG + Intronic
966790652 3:183666421-183666443 CAAAAAATACAAAATTAGCTAGG - Intronic
966811318 3:183847402-183847424 AAAAATGAACAAAATCAGCTGGG + Intronic
966894568 3:184434043-184434065 CTAAATATACAAAATTAGCTGGG - Intronic
966965203 3:184984452-184984474 CTAAAAATACAAAATCAGCTGGG - Intronic
966987445 3:185194449-185194471 CTAAAAATACAAAATCAGCTGGG + Intronic
966990847 3:185228515-185228537 CTAAAAGTACAAAATTAGCTGGG + Intronic
967009193 3:185415742-185415764 CTAAAAATACAAAATCAGCTGGG - Intronic
967071681 3:185967853-185967875 CTAAAAATACAAAATCAGCTGGG + Intergenic
967895432 3:194392218-194392240 CAAAAAATACAAAGTTAGCTGGG - Intergenic
967912230 3:194551932-194551954 CTAAAAGTACAAAATTAGCTGGG + Intergenic
968080264 3:195841472-195841494 AAAAAAGTACAAAATTAGCTGGG - Intergenic
968252699 3:197236150-197236172 CAAAAAGTAAAAAATCAGCTGGG + Intronic
968339472 3:197942754-197942776 CTAAAAGTACAAAATTAGCTGGG + Intronic
968463056 4:735383-735405 CTAAAAGTACAAAATTAGCTGGG + Intronic
968674128 4:1868260-1868282 AAAAAACTACAAAATCAGCTGGG - Intergenic
968768989 4:2491601-2491623 CTAAAAATACAAAATCAGCTGGG - Intronic
968784500 4:2609766-2609788 AAAAATATAAAAAATCAGCTGGG + Intronic
969268728 4:6084154-6084176 CTAAATGTACAAAATTAGCCGGG + Intronic
969336597 4:6513980-6514002 AAAAATGTTCAAATACAGATGGG + Intronic
969565539 4:7975055-7975077 CAAAAAGTAAAAAATTAGCTGGG + Intronic
970005065 4:11402480-11402502 CCAAATGTACCAATTGTGCTTGG + Intronic
970359590 4:15295545-15295567 CAACATGCACCAATTCAGTTGGG + Intergenic
970626216 4:17887018-17887040 AAAAATATACTAATTCAACTGGG + Intronic
970652790 4:18197048-18197070 CAAATTTTACAAAGTCAGTTTGG - Intergenic
970845288 4:20530442-20530464 CAAAAAGTACAAAATTAGCTGGG - Intronic
970992467 4:22228684-22228706 TAAAATGTACAAATAAACCTTGG + Intergenic
971242826 4:24903959-24903981 CTAAAAATACAAAATCAGCTGGG - Intronic
971526520 4:27625774-27625796 CTAAAAATACAAAATCAGCTGGG - Intergenic
971701336 4:29981490-29981512 CAAAAAGTACAAATTTTGATAGG + Intergenic
971712472 4:30133341-30133363 CAAAAAATACAAAATTAGCTGGG - Intergenic
971777026 4:30979163-30979185 AAAAATATAAAAAATCAGCTGGG + Intronic
971836462 4:31770031-31770053 AAAAATTTACATTTTCAGCTAGG + Intergenic
971962006 4:33500984-33501006 CAAAATGTACAACTTCATACAGG - Intergenic
972116528 4:35642551-35642573 CAAAATGCACAAATAAAGCAAGG + Intergenic
972271332 4:37512925-37512947 CTAAAAATACAAAATCAGCTGGG + Intronic
972350056 4:38228504-38228526 CCAAATATACAAAGTTAGCTGGG - Intergenic
972474214 4:39435276-39435298 CAAAATATAAAAAATTAGCTGGG - Intronic
972492569 4:39601784-39601806 CAAAATGTAAAAAATTAGTTGGG + Intronic
972531702 4:39967142-39967164 CAAAATATAAAAAGTTAGCTAGG + Intronic
972634458 4:40870891-40870913 CTAAATATACAAAATTAGCTGGG - Intronic
973079037 4:45966354-45966376 AAAAATGAACAAAATTAGCTGGG - Intergenic
973168836 4:47113223-47113245 TAAAATATACAAAATTAGCTGGG + Intronic
973991850 4:56417008-56417030 CTAAATATACAAAATTAGCTGGG - Intronic
974047886 4:56912673-56912695 CTAAAAATACAAAATCAGCTGGG - Intronic
974057451 4:56998356-56998378 CTAAATATACAAAATTAGCTGGG - Intronic
974091925 4:57320563-57320585 CCATATGTACACATTCAGCAGGG + Intergenic
974222589 4:58995807-58995829 AAAAATTTAAAAAATCAGCTGGG - Intergenic
974286760 4:59878969-59878991 CAAATTTTACAAAGTCAGTTTGG + Intergenic
974332371 4:60497116-60497138 CAAAATATAAAAAATTAGCTGGG + Intergenic
974345607 4:60677184-60677206 CAAAATGCAAAAAATTAGCTAGG - Intergenic
974382306 4:61156919-61156941 CTAAAAATACAAAATCAGCTGGG - Intergenic
974568553 4:63611575-63611597 AAAAATATAAAAATTTAGCTGGG + Intergenic
974605859 4:64148599-64148621 CTAAAAGTACAAAATTAGCTGGG - Intergenic
974929321 4:68343695-68343717 AAAAATATAAAAATTTAGCTCGG - Intronic
974937847 4:68429667-68429689 CTAAATATACAAAATTAGCTGGG - Intergenic
975189878 4:71448022-71448044 TAAAAAGTTCAAAGTCAGCTGGG + Intronic
975356324 4:73409525-73409547 CAAAATGGACAAAATCAGGTTGG - Intronic
975618963 4:76276531-76276553 CTAAATATACAAAATTAGCTGGG - Intronic
975756310 4:77574942-77574964 CAAAATGTAAATATTTACCTAGG + Intronic
975853467 4:78597773-78597795 CAAAAAATACAAAATTAGCTGGG - Intronic
975913062 4:79291561-79291583 CTAAAAATACAAAATCAGCTGGG + Intronic
976209345 4:82651750-82651772 CAAAAAATACAAAATCAGCCAGG + Intronic
976358163 4:84145148-84145170 CAAAATGTACAACTGCAACATGG - Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
977129168 4:93212550-93212572 CAAAAGTTAGAAATTCAGATAGG + Intronic
977201383 4:94120806-94120828 CTAAAAATACAAAATCAGCTGGG + Intergenic
977481210 4:97578263-97578285 AAAAATACACAAATTTAGCTGGG - Intronic
978531646 4:109720905-109720927 CTAAATATACAAAATTAGCTGGG + Intronic
978752083 4:112261269-112261291 CAAAAAATACAAAATTAGCTTGG + Intronic
978780499 4:112548100-112548122 CAAAAAATACAAAATTAGCTGGG - Intronic
979387548 4:120087119-120087141 CTAAATATACAAAATTAGCTAGG + Intergenic
979534819 4:121807645-121807667 CCAAAATTACAAATGCAGCTAGG + Intronic
979959062 4:126993729-126993751 CAAAAAATACAAAATTAGCTGGG + Intergenic
980440040 4:132830658-132830680 AAAAAAGTACAAAATTAGCTGGG + Intergenic
980483839 4:133426760-133426782 CTAAAAATACAAAATCAGCTGGG + Intergenic
980490373 4:133517515-133517537 CAAAATGTGCTAATGCAGGTCGG - Intergenic
980633287 4:135466535-135466557 GAAAATGTTCAACTTCATCTGGG - Intergenic
980959850 4:139464118-139464140 CAAAAAGTAAAAACTTAGCTGGG + Intronic
981203737 4:142014963-142014985 TAAAATGTAAAAAATCAGCTGGG + Intergenic
981311070 4:143298676-143298698 CAAAATTTAAAAATTTAGCATGG - Intergenic
981597706 4:146445999-146446021 CAAAAGGTAAAATTTCAGGTGGG + Intronic
981705636 4:147656451-147656473 CAAAATGAAAAAATTTAGCTGGG - Intronic
981708095 4:147682338-147682360 CTAAAAGTACAAAATTAGCTGGG - Intronic
982191394 4:152859220-152859242 AAAAATACAAAAATTCAGCTGGG - Intronic
982532460 4:156562611-156562633 CTAAAAATACAAAATCAGCTGGG + Intergenic
982842540 4:160209477-160209499 ACAAATGGTCAAATTCAGCTTGG - Intergenic
983204869 4:164901762-164901784 CAAAAAATACAAAATTAGCTGGG + Intergenic
983223767 4:165067373-165067395 CTAAAAGTACAAAATGAGCTGGG + Intergenic
983295541 4:165863441-165863463 CTAAAAGTACAAAATTAGCTGGG - Intergenic
983353653 4:166628036-166628058 CAAAAAATACAAATTTAGCAGGG + Intergenic
983431565 4:167657608-167657630 AAAAATATAAAAAATCAGCTGGG - Intergenic
983482527 4:168292338-168292360 AAAAATGTAATAATTCAGCTGGG - Intronic
983558569 4:169079426-169079448 CTAAAAGTACAAAATTAGCTGGG - Intergenic
983571424 4:169212223-169212245 CTAAAAATACAAAATCAGCTGGG - Intronic
983617961 4:169728672-169728694 CTAAATATACAAAATTAGCTGGG - Intergenic
983890973 4:173029806-173029828 CAAAATGTTTAAATCCAGGTTGG - Intronic
983916648 4:173299683-173299705 CTAAATATACAAAATTAGCTGGG + Intronic
984030668 4:174599907-174599929 CTAAAAGTACAAAATTAGCTGGG + Intergenic
984118810 4:175715902-175715924 CTAAATATACAAAATTAGCTGGG + Intronic
984416734 4:179470199-179470221 AAAAATGCAAAAATTTAGCTGGG - Intergenic
984636379 4:182114884-182114906 CAAAATCCACAAATCCAGCCAGG + Intergenic
984739270 4:183143645-183143667 AAAAATGCAAAAATTTAGCTGGG + Intronic
984778041 4:183501105-183501127 AAAAATGCAAAAAATCAGCTGGG - Intergenic
984937840 4:184904847-184904869 CAAAAAATACAAAATGAGCTAGG + Intergenic
985080948 4:186263298-186263320 TAAAATGTACAAAATCAGCTTGG + Intergenic
985990114 5:3550262-3550284 AAAAATATACAAAATTAGCTGGG + Intergenic
986100954 5:4610709-4610731 AATAATATTCAAATTCAGCTGGG - Intergenic
986355751 5:6924025-6924047 CAAAATGTAAAAACTTAGTTGGG - Intergenic
986428303 5:7656213-7656235 CTAAAAATACAAAATCAGCTGGG - Intronic
986677344 5:10197709-10197731 CTAAAAATACAAAATCAGCTGGG + Intergenic
986704857 5:10446498-10446520 TAAAATATAAAAAATCAGCTGGG + Intronic
986774796 5:11004600-11004622 CTAAAAGTACAAAATTAGCTGGG + Intronic
987374766 5:17223616-17223638 AAAAAAGTACAAATTCAGTATGG - Intronic
987715443 5:21563300-21563322 CAAAAAGTACAAAGTCAGGTGGG + Intergenic
988170472 5:27648658-27648680 AAAAATACAAAAATTCAGCTGGG - Intergenic
988286012 5:29217260-29217282 AAAAATCTACAAATTCCCCTTGG - Intergenic
988596665 5:32599573-32599595 CCAAATATACAAATTTAGGTTGG - Intronic
989031237 5:37120407-37120429 CAAAAAGCCCAAATTAAGCTGGG + Intronic
989051068 5:37321018-37321040 CAAAAAGCACAAATTCAGGATGG + Intronic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989337472 5:40335835-40335857 CCAGAGGTAAAAATTCAGCTGGG + Intergenic
989397088 5:40968770-40968792 TAAAAAGTACAAAATTAGCTGGG - Intronic
989437735 5:41434393-41434415 AAAAATGTACAATTGCAACTGGG + Intronic
989468034 5:41781062-41781084 AAAAAAATACAAAATCAGCTGGG - Intronic
989635993 5:43534358-43534380 CTAAAACTACAAAGTCAGCTGGG - Intronic
989741512 5:44779076-44779098 AAAAATATACAAAATAAGCTGGG + Intergenic
990001408 5:50897780-50897802 AAAAATGTACAAAATTAGCCAGG - Intergenic
990081260 5:51916245-51916267 CAAAATATAAAAAATTAGCTGGG - Intergenic
990281738 5:54258604-54258626 CAGAATGTACAAATTCCCCAGGG + Intronic
990441541 5:55850927-55850949 CTAAAAATACAAAATCAGCTGGG + Intergenic
990588800 5:57240811-57240833 CTAAAAATACAAATTTAGCTGGG + Intronic
990897215 5:60712507-60712529 AAAAATATAAAAATTTAGCTGGG - Intergenic
991063103 5:62399303-62399325 CTAAAAATACAAATTTAGCTGGG + Intronic
991093951 5:62719800-62719822 GAAAATGTTAAAATTCAGCTAGG - Intergenic
991413875 5:66371463-66371485 CAAAATATACACACACAGCTAGG - Intergenic
992005318 5:72471712-72471734 AAAAATGTAAAAATTCATATTGG + Intronic
992115816 5:73537814-73537836 CTAAAAATACAAAATCAGCTGGG - Intergenic
992220064 5:74563116-74563138 CAAAAAATACAAAATTAGCTGGG - Intergenic
992445805 5:76832438-76832460 CAAAAAGTAAAAAATTAGCTGGG + Intronic
992491146 5:77246009-77246031 AAAAATGTAAAAAGTTAGCTGGG - Intronic
992569567 5:78041396-78041418 GAAAATGTAAAAAATTAGCTGGG + Intronic
992690224 5:79234686-79234708 CAAAATGTTAAAAACCAGCTGGG + Intronic
992831071 5:80593975-80593997 CTAAAAATACAAAATCAGCTGGG + Intergenic
993161796 5:84300972-84300994 AAAATTGTACAGAATCAGCTGGG + Intronic
993195254 5:84733842-84733864 CTAAAAGTACAAAATTAGCTGGG - Intergenic
993234492 5:85286213-85286235 CTAAAAATACAAAATCAGCTGGG + Intergenic
993987570 5:94615755-94615777 AAAAATGTACAAATACTTCTCGG + Intronic
994047192 5:95323340-95323362 CAAAAAGTACAAAATTAGCCAGG + Intergenic
994284086 5:97942106-97942128 TAAAAAGTACAAAATTAGCTGGG + Intergenic
994370846 5:98965489-98965511 CAAAAAATACAAAATTAGCTGGG - Intergenic
994567621 5:101471455-101471477 AAAATTGTTCAAATTCATCTTGG - Intergenic
994890526 5:105628474-105628496 CTAAAAGTACAAATTTAGCCAGG + Intergenic
995155615 5:108908875-108908897 CAAAAAGTAAAAAATTAGCTGGG + Intronic
995249821 5:109980177-109980199 CTAAAAGTACAAAATTAGCTGGG + Intergenic
995338186 5:111026730-111026752 CTAACTTTACAAATTCAGATTGG + Intergenic
995760199 5:115554276-115554298 CAAAAAATACAAAATTAGCTGGG + Intergenic
995864754 5:116679044-116679066 AAAAAAGAATAAATTCAGCTGGG - Intergenic
996281156 5:121730462-121730484 AAAAATGTAAAAAATCAGCTGGG + Intergenic
996378392 5:122839644-122839666 CTAAAAATACAAATTTAGCTGGG - Intergenic
996558936 5:124808073-124808095 CTAAAAATACAAATTTAGCTGGG - Intergenic
996718525 5:126607562-126607584 CAAAAAATACAAAATTAGCTGGG - Intronic
996944829 5:129054660-129054682 CTAAAAATACAAAATCAGCTGGG + Intergenic
997333313 5:133083696-133083718 CAAAAAATACAAAATTAGCTGGG - Intronic
997461082 5:134052952-134052974 CTAAAAATACAAAATCAGCTGGG + Intergenic
997494074 5:134306334-134306356 AAAAATGAACAAAATTAGCTGGG + Intronic
997787305 5:136725441-136725463 AAAAATATAAAAATTTAGCTGGG - Intergenic
997940021 5:138148903-138148925 CAAAAAATAAAAAATCAGCTGGG + Intronic
997954901 5:138271737-138271759 CAAAAAATACAAAATTAGCTGGG - Intronic
998011676 5:138700166-138700188 AAAAATGTAAAAAATTAGCTGGG + Intronic
998020183 5:138763501-138763523 AAAAATGTAAAAAATTAGCTGGG - Intronic
998433043 5:142083166-142083188 CTAAAAATACAAAATCAGCTGGG - Intergenic
998663254 5:144264610-144264632 GAAAATGTAAAAAGTTAGCTGGG + Intronic
998723771 5:144985371-144985393 CAAAAAATAAAAAATCAGCTGGG + Intergenic
998842031 5:146264342-146264364 CTAAAAATACAAAATCAGCTGGG - Intronic
998853079 5:146369295-146369317 CCAAAAATACAAAATCAGCTGGG + Intergenic
998857019 5:146403559-146403581 CAAAATTTAAAAAATTAGCTGGG + Intergenic
998956889 5:147447707-147447729 CTAAAAATACAAAATCAGCTGGG + Intronic
999117833 5:149179591-149179613 AAAAATGTACAAATTAATTTAGG - Intronic
999159570 5:149484207-149484229 CTAAAAGTACAAAATTAGCTGGG + Intergenic
999177951 5:149645200-149645222 CAAAAAGTAAAAAATTAGCTGGG - Intergenic
999401301 5:151266315-151266337 CAAAAAATACAAAATTAGCTGGG + Intronic
999756365 5:154667652-154667674 CTAAAAATACAAAATCAGCTGGG - Intergenic
999772687 5:154787374-154787396 CAGAATATACAGGTTCAGCTGGG - Intronic
999859350 5:155628745-155628767 CTAAAAATACAAAGTCAGCTGGG + Intergenic
1000712884 5:164602253-164602275 CTAAAAATACAAAATCAGCTGGG + Intergenic
1000876683 5:166647949-166647971 CTAAATGAACCAATACAGCTAGG + Intergenic
1000965053 5:167646611-167646633 CAAGAGACACAAATTCAGCTAGG + Intronic
1001089761 5:168728755-168728777 CAAAAAATAAAAAGTCAGCTGGG + Intronic
1001182448 5:169533228-169533250 AAAAATGTAAAAAATTAGCTGGG - Intergenic
1001219909 5:169891687-169891709 CAAAAAGAACAAAGTCAGCCGGG + Intronic
1001593839 5:172885288-172885310 AAAAATGAACAAAATTAGCTGGG - Intronic
1001741357 5:174055435-174055457 AAAAATGTAAAAAATTAGCTGGG + Intronic
1001786516 5:174418533-174418555 CTAAAAATACAAAATCAGCTGGG + Intergenic
1001975996 5:175999175-175999197 TGAAACATACAAATTCAGCTGGG + Intronic
1002015408 5:176317869-176317891 CAAAATGTACAAACAAAGCAAGG + Intronic
1002241429 5:177844597-177844619 TGAAACATACAAATTCAGCTGGG - Intergenic
1002505226 5:179674723-179674745 CAAAAAGTAAAAAATTAGCTGGG - Intergenic
1002531157 5:179846442-179846464 CTAAAAATACAAAATCAGCTGGG - Intronic
1002539246 5:179895020-179895042 CAAAAAGTACAAAATTAGCCAGG - Intronic
1002692934 5:181063341-181063363 AAAAATATAAAAAATCAGCTGGG + Intergenic
1002995757 6:2282927-2282949 CTAAAAATACAAAATCAGCTGGG + Intergenic
1003110540 6:3248972-3248994 CAAAAAGTACAAAATTAGCCAGG + Intronic
1003575630 6:7291910-7291932 ACAAATATAAAAATTCAGCTGGG + Intronic
1003891772 6:10570094-10570116 CAAAAATTACAAAATTAGCTGGG - Intronic
1003985860 6:11434595-11434617 AAAAATGCAAAAATTTAGCTGGG - Intergenic
1004293624 6:14390314-14390336 CAAAATGAACAAGGGCAGCTTGG + Intergenic
1004657572 6:17678782-17678804 AAAAATTTAAAAAGTCAGCTGGG + Intronic
1004980718 6:21020626-21020648 CTAAAAATACAAAATCAGCTGGG - Intronic
1004998940 6:21221387-21221409 CAAAAAATACAAAATTAGCTGGG - Intronic
1005204834 6:23390671-23390693 CAGAAAGTACAAAATTAGCTGGG + Intergenic
1005722168 6:28614122-28614144 CTAAAAATACAAAATCAGCTGGG - Intronic
1005853777 6:29844417-29844439 CTAAATATACAAAATTAGCTGGG - Intergenic
1005933335 6:30499609-30499631 CTAAAGGTACAAAATCAGCCGGG - Intergenic
1006087650 6:31607938-31607960 CTAAATGTACAAAATTAGCCAGG - Intergenic
1006214274 6:32426289-32426311 CTAAAAATACAAATTTAGCTGGG + Intergenic
1006309125 6:33244931-33244953 AAAAATATAAAAAATCAGCTAGG - Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1006482091 6:34304090-34304112 CTAAAAGTACAAAATCAGCTGGG + Intronic
1006656078 6:35594191-35594213 CAAAATGAAAAAAATCAGCCAGG + Intronic
1007013826 6:38442828-38442850 CTAAAAATACAAATTTAGCTGGG - Intronic
1007437170 6:41822682-41822704 CTAAAAATACAAATTTAGCTGGG + Intronic
1007535526 6:42584155-42584177 CAAAAAATACAAAATTAGCTGGG - Intronic
1007827871 6:44614870-44614892 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1007982709 6:46175440-46175462 CAAAATATAAAAATTTAGCCTGG - Intergenic
1007997422 6:46322937-46322959 GAAAATGAACAAATTAAGGTGGG - Intronic
1008023118 6:46602649-46602671 CTAAAAATACAAAATCAGCTGGG + Intronic
1008198029 6:48549812-48549834 CAACATGTACAAATTTATGTTGG - Intergenic
1008202938 6:48614820-48614842 CTAAAAATACAAATTTAGCTGGG + Intergenic
1008324943 6:50167351-50167373 TAAAATGTACAATTTGAGCCTGG + Intergenic
1008591062 6:52994586-52994608 CAGATTTTCCAAATTCAGCTGGG + Intronic
1008688664 6:53952726-53952748 CTAAATATACAAAATTAGCTGGG - Intronic
1008958333 6:57240261-57240283 CTAAAAATACAAATTTAGCTGGG - Intergenic
1009001282 6:57718744-57718766 CAAAAAGCACAAAGTCAGGTGGG - Intergenic
1009441814 6:63688494-63688516 CAAAAAATACAAAATAAGCTGGG - Intronic
1009559977 6:65227070-65227092 CTAAATATACAAAATTAGCTGGG + Intronic
1009573607 6:65423147-65423169 TAAAATTTAAAAATTCAGATTGG + Intronic
1009631930 6:66210935-66210957 CTAAAAATACAAAATCAGCTGGG + Intergenic
1009831846 6:68947888-68947910 CAAGAGTAACAAATTCAGCTAGG - Intronic
1009971444 6:70629116-70629138 CTAAAAATACAAAATCAGCTGGG + Intergenic
1010005078 6:70986754-70986776 CTAAAAATACAAATTTAGCTGGG - Intergenic
1010072609 6:71761575-71761597 CAAAATGCAAAAATTTAGCCAGG + Intergenic
1010251605 6:73713195-73713217 TTAAATTTACAAATACAGCTTGG - Intronic
1010750992 6:79615975-79615997 CAAAAAGTAGAAAATCAGCTAGG - Intergenic
1010933266 6:81829586-81829608 CTAAAAATACAAAATCAGCTGGG - Intergenic
1011212825 6:84972474-84972496 TAAAATTTAAAAACTCAGCTGGG - Intergenic
1011256156 6:85423228-85423250 AAAAATGTAAAAAATTAGCTGGG + Intergenic
1011276245 6:85634340-85634362 CAAAATGTACCAATTATGGTAGG - Intronic
1011493857 6:87919864-87919886 CAAGAAGTCCAAATTCAGCAGGG + Intergenic
1012466513 6:99522020-99522042 CAAAACAAACAAAATCAGCTGGG - Intergenic
1012479698 6:99652844-99652866 CAAAATGTGCAAATGCAGAGAGG - Intergenic
1012537993 6:100322775-100322797 AAAAATATACAAAATTAGCTTGG - Intergenic
1013019173 6:106194696-106194718 CTAAAAGTACAAAATTAGCTAGG - Intronic
1013163277 6:107566676-107566698 CAACATGTACAAATCCATCATGG + Intronic
1013472908 6:110480823-110480845 AAAAATTTACAAAATTAGCTGGG - Intergenic
1013533732 6:111044011-111044033 CAAAAAATACAAAATCAGCTGGG - Intergenic
1013778395 6:113703770-113703792 CTAAAAATACAAAATCAGCTGGG - Intergenic
1014025144 6:116637899-116637921 CTAAATATACAAAATTAGCTGGG + Intronic
1014108212 6:117591011-117591033 CTAAATATACAAAATTAGCTGGG - Intronic
1014216142 6:118754432-118754454 CTAAATATACAAAATTAGCTGGG - Intergenic
1015520088 6:134121338-134121360 AAAAATATAAAAATTTAGCTGGG + Intergenic
1015630493 6:135227514-135227536 CAAAATGTGCAAATAAAGCAAGG - Intergenic
1016320002 6:142832030-142832052 AAAAATGCAAAAAATCAGCTGGG + Intronic
1016358644 6:143244807-143244829 AAAAATGTATAAATTCAGCTTGG + Intronic
1016541829 6:145174526-145174548 CTAAAAATACAAAATCAGCTGGG - Intergenic
1016553231 6:145306321-145306343 CAATTTGTATAAATTCATCTAGG + Intergenic
1016756315 6:147691153-147691175 CTAAAAATACAAAATCAGCTGGG - Intronic
1016837989 6:148498248-148498270 CAAAAAAAACAAATTTAGCTGGG + Intronic
1017041599 6:150312838-150312860 CAAAATGCACAAATAAAGCAAGG - Intergenic
1017617608 6:156261626-156261648 AAAAATATAAAAAATCAGCTGGG + Intergenic
1018314794 6:162546262-162546284 CTAAAAATACAAATTTAGCTGGG - Intronic
1018409733 6:163531799-163531821 TAAAATGTACAAACTCAGCCGGG - Intronic
1018473886 6:164121764-164121786 AAAAATGGACTAATACAGCTGGG - Intergenic
1018852271 6:167649270-167649292 CTAAAAATACAAAATCAGCTGGG + Intergenic
1019283825 7:214162-214184 CTAAAAGTACAAAATTAGCTGGG + Intronic
1019583659 7:1783319-1783341 AAAAATATAAAAAATCAGCTGGG - Intergenic
1019809453 7:3154241-3154263 AAAAATGTAAAAAGTCAGCAGGG - Intronic
1019882100 7:3870707-3870729 CAAAATGAACAAATTAACATTGG + Intronic
1019945909 7:4329065-4329087 CAAAATTTTAAAAATCAGCTGGG + Intergenic
1020015825 7:4831028-4831050 AAAAAAATACAAAATCAGCTGGG + Intronic
1020022439 7:4877280-4877302 CAAAAAGTAAAAAATTAGCTGGG + Intronic
1020030133 7:4926903-4926925 AAAAATATAAAAAATCAGCTGGG - Intronic
1020102662 7:5403319-5403341 CTAAAAATACAAATTTAGCTGGG - Intronic
1020152149 7:5690875-5690897 TAAAATGTACACATTCATCATGG + Intronic
1020160058 7:5763728-5763750 AAAATTTTAAAAATTCAGCTAGG - Intronic
1020579394 7:9975986-9976008 CTAAAAATACAAATTTAGCTGGG - Intergenic
1020652122 7:10888601-10888623 CAAATTGTCCTAATGCAGCTAGG - Intergenic
1020706516 7:11550718-11550740 GAAAATGAACTAATTCAGATAGG + Intronic
1021251085 7:18326023-18326045 CAAAGTGAACACATTCTGCTGGG + Intronic
1021441529 7:20682467-20682489 CATAAAGGACAAATTCAGGTAGG + Intronic
1021455328 7:20824002-20824024 CTAAAAATACAAAATCAGCTGGG - Intergenic
1021651865 7:22840487-22840509 CTAAAAATACAAAATCAGCTGGG + Intergenic
1021665648 7:22975875-22975897 CAAATTTTAAAAAATCAGCTGGG - Intronic
1022006243 7:26268088-26268110 AAAAAGATACAAATTTAGCTGGG + Intergenic
1022121430 7:27312198-27312220 CAAAAAATACAAAATTAGCTGGG + Intergenic
1022128703 7:27382217-27382239 AAAAATGTAAAAAATTAGCTGGG - Intergenic
1022237734 7:28477951-28477973 CAAAAAGTAAAAAATTAGCTGGG + Intronic
1022731654 7:33032260-33032282 CTAAATATACAAAATTAGCTGGG + Intronic
1022825551 7:34008981-34009003 AAAAATGTACAAAGTTAGCCAGG - Intronic
1022938677 7:35208579-35208601 CTAAAAATACAAAATCAGCTGGG + Intronic
1023376056 7:39556676-39556698 CAATATGTTCAAAGTCAGCAAGG + Intergenic
1023408996 7:39869113-39869135 CTAAAAATACAAAATCAGCTGGG + Intergenic
1023443318 7:40206785-40206807 GAAAATGTACATCTTCAGCACGG + Intronic
1023465384 7:40448682-40448704 CAAAAAGTACAAAATTAGCTGGG + Intronic
1023505421 7:40895090-40895112 GAAAATGTACATATTCATCATGG + Intergenic
1023563183 7:41496770-41496792 CAAAATTTAAAAAATTAGCTGGG - Intergenic
1023893663 7:44413892-44413914 CAAAATACAAAAAATCAGCTGGG + Intronic
1024525076 7:50341300-50341322 AAAAATGCAAAAAATCAGCTGGG - Intronic
1024567088 7:50690133-50690155 CTAAAAGTACAAAATTAGCTGGG + Intronic
1024675005 7:51630411-51630433 TAAAAGGTTCATATTCAGCTGGG - Intergenic
1025058764 7:55786348-55786370 TAAAATGTTCAAATTAGGCTGGG - Intergenic
1025571175 7:62570720-62570742 AATAATGAACAAATTCAGCATGG - Intergenic
1025616341 7:63121009-63121031 AAAAATGTTCAGATTCAGCCAGG - Intergenic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1025631101 7:63273966-63273988 CTAAAACTACAAATTTAGCTGGG - Intergenic
1025631230 7:63274869-63274891 CTAAAACTACAAATTTAGCTGGG - Intergenic
1025744803 7:64233329-64233351 AAAAATTTAAAAATTAAGCTGGG + Intronic
1025900746 7:65742601-65742623 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1025940325 7:66072196-66072218 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1026143879 7:67728953-67728975 TAAAAAATACAAATTTAGCTGGG + Intergenic
1026234350 7:68513126-68513148 CAAAAAATAAAAAATCAGCTAGG - Intergenic
1026269713 7:68825575-68825597 CAAAAAATAAAAAATCAGCTGGG - Intergenic
1026338646 7:69416571-69416593 CAAAAAATACAAAATTAGCTGGG - Intergenic
1026369114 7:69680963-69680985 TAAAATACTCAAATTCAGCTGGG - Intronic
1026410311 7:70114629-70114651 CTAAAAATACAAAATCAGCTGGG + Intronic
1026454873 7:70562221-70562243 CAAAATGGACAAATACACATGGG + Intronic
1026569111 7:71514032-71514054 CAAAATTTAAAAATTTAGCCGGG + Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026629401 7:72025147-72025169 CTAAAAGTACAAAATTAGCTGGG + Intronic
1026679797 7:72457167-72457189 AAAAATGCAAAAAATCAGCTGGG - Intergenic
1026738713 7:72965234-72965256 CAAAATATAAAAAATGAGCTGGG + Intronic
1026817944 7:73526695-73526717 AAAAATATAAAAATTTAGCTGGG + Intergenic
1027105021 7:75399835-75399857 CAAAATATAAAAAATGAGCTGGG - Intronic
1027113365 7:75458366-75458388 CTAAATATAAAAAATCAGCTGGG + Intronic
1027147137 7:75703480-75703502 CTAAAAATACAAAATCAGCTGGG + Intronic
1027159945 7:75794972-75794994 CAAAATCTTAAAAATCAGCTGGG + Intergenic
1027203241 7:76076111-76076133 CTAAAAATACAAAATCAGCTGGG - Intergenic
1027566805 7:79805095-79805117 CAAAATCTACAAAGACAGCTGGG + Intergenic
1028105475 7:86872061-86872083 CAAAAAATACAAAAACAGCTGGG + Intergenic
1029060417 7:97792046-97792068 CTAAATATACAAAATTAGCTGGG - Intergenic
1029085813 7:98010838-98010860 AAAAATGTAAAAAGTTAGCTAGG + Intergenic
1029217490 7:98961756-98961778 CTAAAAATACAAATTTAGCTGGG + Intronic
1029401299 7:100348357-100348379 CTAAATATACAAAATTAGCTGGG - Intronic
1029523471 7:101079586-101079608 CTAAAAATACAAAATCAGCTGGG + Intergenic
1029969106 7:104771979-104772001 CTAAAAATACAAATTTAGCTGGG - Intronic
1030279854 7:107761673-107761695 CAAAACATAAAAATTCATCTAGG - Intergenic
1030665590 7:112274316-112274338 CAAAAAATAAAAAATCAGCTGGG - Intronic
1030816579 7:114047003-114047025 CTAAAAATACAAATTTAGCTGGG + Intronic
1030930004 7:115511026-115511048 CAAAATATAAATATTCAGCTAGG + Intergenic
1031167909 7:118252553-118252575 CAAAAAGAACAAACTTAGCTAGG - Intergenic
1031456378 7:121985558-121985580 CCAAATGTACAAATGCAACCTGG - Intronic
1031488719 7:122361910-122361932 CTAAAAGTACAAAATCAGCAGGG + Intronic
1031520852 7:122763958-122763980 AAAAGTGTATAAATTCAACTTGG + Intronic
1031931022 7:127686049-127686071 CTAAAAATACAAAATCAGCTAGG - Intronic
1031962382 7:128001768-128001790 CTAAAAATACAAAATCAGCTGGG + Intronic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032607331 7:133369963-133369985 CTAAAAGTACAAAATTAGCTGGG - Intronic
1032902871 7:136330950-136330972 AAAAATGTAAAAATTAAGCTGGG - Intergenic
1033068136 7:138175846-138175868 CAAAAAATACAAAATTAGCTGGG + Intergenic
1033084026 7:138325849-138325871 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1033335309 7:140447275-140447297 TAAAATATACAAAATCAGCTGGG - Intergenic
1033920862 7:146389860-146389882 CTAAAAATACAAATTTAGCTGGG - Intronic
1034154892 7:148948642-148948664 CAAAACATAAAAATTAAGCTGGG + Intergenic
1034214270 7:149392664-149392686 CAAAATTTAAAAAATTAGCTGGG + Intergenic
1034516861 7:151587921-151587943 CAAGATGTCAAAATTCAACTGGG + Intronic
1034609245 7:152350087-152350109 CTAAAAATACAAAATCAGCTGGG + Intronic
1034962332 7:155370792-155370814 CTAAAAATACAAATTTAGCTGGG + Intergenic
1035402356 7:158575523-158575545 AAAAATGTAAAAAATTAGCTGGG - Intronic
1035413006 7:158660575-158660597 CAAAATTTAAAAAATTAGCTGGG - Intronic
1035755067 8:2024686-2024708 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1035785760 8:2259331-2259353 TAAAATGTACAAATCAAGCATGG - Intergenic
1035807047 8:2462385-2462407 TAAAATGTACAAATCAAGCATGG + Intergenic
1035903156 8:3479439-3479461 CTAAAAGTACAAAATTAGCTGGG - Intronic
1036147666 8:6269703-6269725 CTAAAAATACAAAATCAGCTGGG + Intergenic
1036469720 8:9041893-9041915 CTAAAAATACAAAATCAGCTGGG - Intronic
1036531988 8:9599347-9599369 CAATATATACAAACTCGGCTTGG - Intronic
1036792298 8:11729272-11729294 CAAAAAGAAAAAATGCAGCTGGG + Intronic
1036824557 8:11966076-11966098 AAAAATATACAAAATTAGCTGGG - Intergenic
1036837354 8:12084639-12084661 CTAAAGATACAAATTTAGCTGGG + Intergenic
1036859147 8:12330883-12330905 CTAAAGATACAAATTTAGCTGGG + Intergenic
1036921058 8:12855733-12855755 CTAAACTTACAATTTCAGCTGGG - Intergenic
1037119901 8:15270676-15270698 CAAAAAGTACAAAGTTAGCTGGG + Intergenic
1037217391 8:16473575-16473597 CAAAATATATAAATACACCTAGG - Intronic
1037319930 8:17632496-17632518 CTAAAAGTACAAAATTAGCTGGG - Intronic
1037536067 8:19826061-19826083 AAAAATTTAAAAATGCAGCTAGG - Intronic
1037965823 8:23133411-23133433 TAAAATGTATAAAACCAGCTGGG + Intergenic
1038037722 8:23700734-23700756 CAAAATTTAAAAAATTAGCTGGG + Intergenic
1038501878 8:28051759-28051781 CTAAAAGTACAAAATTAGCTGGG + Intronic
1038580480 8:28744497-28744519 AAAAATATACAAATTAGGCTGGG + Intronic
1038733169 8:30145695-30145717 AAAAATGCAAAAATTTAGCTGGG + Intronic
1038783318 8:30587709-30587731 CTAAAAATACAAACTCAGCTGGG + Intronic
1039057737 8:33550092-33550114 CAAAAAATACAAAATTAGCTGGG - Intronic
1039321883 8:36441006-36441028 CTAAATTTTCAAATTCATCTTGG + Intergenic
1039497898 8:37994948-37994970 CAAAATATAAAAAATTAGCTAGG - Intergenic
1039531294 8:38265452-38265474 CTAAAAATACAAAATCAGCTGGG - Intronic
1039607054 8:38889777-38889799 CTAAAAATACAAAATCAGCTGGG + Intergenic
1039619787 8:38986011-38986033 TAAAATAAACAAAATCAGCTGGG + Intronic
1039690781 8:39862367-39862389 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1039754631 8:40510625-40510647 AAAAATGTAAAAAATTAGCTGGG - Intergenic
1041096506 8:54355631-54355653 CAAAAAATACAAAATTAGCTGGG + Intergenic
1041228023 8:55719649-55719671 GAAAATTTAAAAATTCGGCTGGG + Intronic
1041763506 8:61393042-61393064 CTAAATATACAAAATTAGCTGGG - Intronic
1041803708 8:61826804-61826826 AAAAATATAAAAATTTAGCTGGG + Intergenic
1041844528 8:62312654-62312676 CAAAAAATACAAAATTAGCTGGG + Intronic
1042028454 8:64448511-64448533 AAAAATATACAAAATTAGCTGGG + Intergenic
1042101522 8:65280100-65280122 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1042246978 8:66717862-66717884 CCAAAAATACAAAATCAGCTGGG - Intronic
1042565407 8:70105351-70105373 CAAAATGTAAAAAATTAGCTGGG + Intergenic
1043293982 8:78641315-78641337 CTAAAAATACAAAATCAGCTGGG + Intergenic
1043446739 8:80326535-80326557 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1043930919 8:86090981-86091003 AAAATTGTACAAAATGAGCTTGG + Intronic
1043999669 8:86864607-86864629 CTAAATATACAAAATCAGCTGGG + Intergenic
1044027818 8:87195521-87195543 CAAAAAGTCAATATTCAGCTGGG - Intronic
1044200126 8:89425095-89425117 GAAAATGTCCAAAATTAGCTTGG - Intergenic
1044288149 8:90435184-90435206 GAAAATTTACAAATTTAGGTAGG + Intergenic
1044578487 8:93797819-93797841 CAAAAAATACAAAATTAGCTGGG + Intronic
1045160416 8:99536108-99536130 CTAAATATACAAAATTAGCTGGG - Intronic
1045230364 8:100300351-100300373 CAAAAGCAACAAAATCAGCTGGG + Intronic
1045950689 8:107848723-107848745 TAAAATGTCCAAATTAAGGTTGG - Intergenic
1046312161 8:112451697-112451719 CTAAATGTACAAAATTAGCCGGG - Intronic
1046998632 8:120551563-120551585 AAAAATGCAAAAAATCAGCTGGG + Intronic
1047249584 8:123171570-123171592 AAAAATGTAAAAACTCAGCCAGG + Intergenic
1047348768 8:124053695-124053717 CAAAACATAAAAATTCAGCCGGG + Intronic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1047640688 8:126818288-126818310 CTAAAAATACAAAATCAGCTGGG - Intergenic
1047944600 8:129862629-129862651 AAAAATAAAAAAATTCAGCTGGG - Intronic
1047971122 8:130085571-130085593 CAAAAATTAAAAAATCAGCTGGG + Intronic
1048222790 8:132558261-132558283 CTAAAAATACAAAATCAGCTGGG - Intergenic
1048330908 8:133470256-133470278 CTAAAAATACAAAATCAGCTGGG + Intronic
1048665927 8:136661252-136661274 AAAAATGTATAAATTCAACTGGG + Intergenic
1049248144 8:141573774-141573796 CAAAATGCACAAATAAAGCAAGG - Intergenic
1049516587 8:143061703-143061725 CTAAATATACAAAATTAGCTGGG - Intergenic
1050214367 9:3306018-3306040 AAAAATTTATAAATTCTGCTAGG + Intronic
1050227325 9:3474936-3474958 CAAAAAGTAAAAAATTAGCTGGG + Intronic
1050270105 9:3934568-3934590 CTAAAAATACAAAATCAGCTGGG - Intronic
1050434056 9:5590745-5590767 CTAAATATACAAATTTAGCTGGG - Intergenic
1050448567 9:5754565-5754587 CAAAATATACAAAATTAGCTAGG + Intronic
1050939234 9:11438968-11438990 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1050955720 9:11656633-11656655 CAGATTCTACAGATTCAGCTTGG + Intergenic
1051415775 9:16838398-16838420 GAAAAAATACAAAATCAGCTGGG + Intronic
1051632157 9:19150296-19150318 CTAAATATACAAAATTAGCTGGG + Intergenic
1051646550 9:19274454-19274476 CTAAATATACAAAATTAGCTGGG - Intronic
1051919081 9:22243160-22243182 CAAACTGGCTAAATTCAGCTAGG - Intergenic
1052090265 9:24319121-24319143 CTAAAAATACAAATTTAGCTGGG + Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052795911 9:32923262-32923284 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052913564 9:33906281-33906303 CTAAAAATACAAAATCAGCTGGG - Intronic
1053022488 9:34704673-34704695 AAAAATGAACAAAATTAGCTGGG + Intergenic
1053027442 9:34741521-34741543 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1053085893 9:35221227-35221249 AAAAATACACAAAATCAGCTGGG - Intronic
1053220644 9:36309824-36309846 AAAAATGAACAAAATTAGCTGGG - Intergenic
1053232008 9:36418187-36418209 CAAAAAATACAAAATTAGCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053581449 9:39408920-39408942 CGAAAATTACAAAATCAGCTGGG + Intergenic
1053845928 9:42236953-42236975 CTAAAATTACAAAATCAGCTGGG + Intergenic
1053945586 9:43306786-43306808 CAGAATCTACAAATTCCTCTGGG - Intergenic
1054103030 9:60967672-60967694 CGAAAATTACAAAATCAGCTGGG + Intergenic
1054583325 9:66939141-66939163 CTAAAATTACAAAATCAGCTGGG - Intergenic
1054825105 9:69565754-69565776 CACAATGTCCACTTTCAGCTAGG + Intronic
1055034439 9:71803104-71803126 CTAAAAATACAAAATCAGCTGGG + Intronic
1055050098 9:71970912-71970934 AAAAATACACAAATTTAGCTGGG - Intronic
1055301110 9:74883986-74884008 CTAAAAGTACAAAATTAGCTGGG + Intronic
1055328259 9:75154884-75154906 AAAAATATACAAAATTAGCTGGG - Intergenic
1055477375 9:76676212-76676234 CAAAGTTTACAAATTCATATCGG - Intronic
1055621407 9:78128860-78128882 CAAAAAATACAAAATTAGCTGGG + Intergenic
1056002614 9:82232812-82232834 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1056212778 9:84380773-84380795 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1056212785 9:84380823-84380845 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1056362680 9:85874590-85874612 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1056502649 9:87224829-87224851 AAAAATGTAGAAAATTAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056708433 9:88970912-88970934 CAAAATATAAAATTTCATCTTGG - Intergenic
1057244677 9:93444773-93444795 CTAAAAATACAAAATCAGCTAGG - Intergenic
1057310129 9:93937662-93937684 CAAAAAGTACAAAATTAGCCAGG - Intergenic
1057349057 9:94279228-94279250 CTAAAAGTACAAAATTAGCTGGG + Intronic
1057383032 9:94585781-94585803 CAAAAGATAAAAATTTAGCTCGG - Intronic
1057383047 9:94585904-94585926 CAAAAGATAAAAATTTAGCTCGG - Intronic
1057580485 9:96283164-96283186 CTAAAAGTACAAAGTTAGCTGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057738760 9:97692128-97692150 CTAAAAGTACAAAATTAGCTGGG + Intronic
1057799815 9:98183798-98183820 AAAAATGTAAAAAATTAGCTGGG + Intronic
1057836380 9:98448711-98448733 CTAAATTTACAGAATCAGCTGGG - Intronic
1058236510 9:102497463-102497485 GAAAAAATAAAAATTCAGCTGGG + Intergenic
1059177296 9:112179087-112179109 CTAAAAGTACAAAATTAGCTAGG - Intergenic
1059198311 9:112391742-112391764 CTAAAAATACAAAATCAGCTGGG + Intronic
1059224330 9:112658015-112658037 CTAAAAGTACAAAATTAGCTGGG - Intronic
1059296798 9:113277837-113277859 CAAAAAGTAGAAAATTAGCTGGG + Intronic
1059334810 9:113562314-113562336 AAAAATGCAAAAAATCAGCTGGG + Intronic
1059354898 9:113691179-113691201 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1059844221 9:118254326-118254348 CAAAATGTACAGTTACAGGTAGG - Intergenic
1060019728 9:120118629-120118651 AAAAATGGACTAATACAGCTGGG + Intergenic
1060161381 9:121368777-121368799 CAAAAAATACAAAATCAGCTGGG + Intronic
1060395544 9:123313801-123313823 CAAAAAATACAAAATTAGCTAGG + Intergenic
1060456422 9:123802861-123802883 CTAAAAGTACAAAATTAGCTGGG - Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1060655255 9:125368127-125368149 CTAAAAATACAAAATCAGCTGGG - Intergenic
1060673385 9:125490376-125490398 CTAAAAATACAAAATCAGCTGGG + Intronic
1060841875 9:126800122-126800144 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1061048378 9:128179831-128179853 CTAAAAGTACAAAATTAGCTGGG - Intronic
1061277521 9:129578026-129578048 CTAAAAATACAAATTTAGCTGGG - Intergenic
1061434732 9:130554048-130554070 AAAAATATAAAAATTCGGCTGGG + Intergenic
1061457288 9:130708191-130708213 AAAAATATAAAAATTCAGCTGGG - Intergenic
1061538563 9:131264882-131264904 CTAAAAGTACAAAATTAGCTGGG - Intronic
1061725107 9:132578198-132578220 CAAAATGTAAAAATTCATGATGG + Intergenic
1061777719 9:132977116-132977138 CAAAAAATACAAAATTAGCTGGG - Intronic
1061782105 9:133002402-133002424 CAAAAAGTACAAAATTAGCCTGG - Intergenic
1061978618 9:134086901-134086923 AAAAATGAACAAAATTAGCTGGG + Intergenic
1061997694 9:134195065-134195087 AAAAATATACAAAATTAGCTGGG - Intergenic
1062419197 9:136471311-136471333 AAAAATGAACAAAATTAGCTGGG + Intronic
1062531605 9:137003618-137003640 CTAAATATACAAAATTAGCTGGG - Intergenic
1062593507 9:137286562-137286584 AAAAATGAACAAAATTAGCTGGG - Intergenic
1203588721 Un_KI270747v1:35364-35386 CAGAATCTACAAATTCCTCTGGG - Intergenic
1185517134 X:708633-708655 CTAAATATACAAAATTAGCTGGG + Intergenic
1185623921 X:1469322-1469344 CAAAAAGTAAAAAATCAGCCAGG - Intronic
1185662843 X:1740848-1740870 CAAAATGTAAAGAATAAGCTGGG - Intergenic
1185766510 X:2729991-2730013 AAAAATGTAAAAAATTAGCTGGG + Intronic
1185801748 X:3017404-3017426 AAAAATGTACAAAATTAGCCAGG + Intronic
1185808148 X:3079503-3079525 CTAAAAATACAAAATCAGCTGGG - Intronic
1185871060 X:3665313-3665335 CTAAAAGTACAAAATTAGCTGGG + Intronic
1186064348 X:5745416-5745438 CAAAAAATACAAAATTAGCTGGG + Intergenic
1186334407 X:8570948-8570970 CAAAATTTAAAAAATTAGCTGGG + Intronic
1186778714 X:12891837-12891859 CTAAATATACAAAATTAGCTGGG + Intergenic
1186969783 X:14829003-14829025 CAAAATGTCAACATTCAGCTGGG - Intergenic
1187343183 X:18439674-18439696 CTAAATATACAAAATTAGCTGGG + Intronic
1187345591 X:18460660-18460682 CAAAAAATACAAAATTAGCTGGG - Intronic
1187596723 X:20781162-20781184 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1188009731 X:25042901-25042923 CTAAATATACAAAATTAGCTGGG + Intergenic
1188184124 X:27092446-27092468 CTAAAAATACAAAATCAGCTGGG + Intergenic
1188291277 X:28391908-28391930 CAAAATTTAAAAAATTAGCTGGG + Intergenic
1188604418 X:32010929-32010951 CAACATGTACAAAACCAGATTGG - Intronic
1188824215 X:34810374-34810396 CTAGATTTTCAAATTCAGCTCGG - Intergenic
1189016309 X:37288150-37288172 CTCAAAGTACAAATTCAACTAGG - Intergenic
1189109444 X:38272430-38272452 CTAAAAGTACAAAATCAGCCAGG + Intronic
1189123155 X:38416794-38416816 AAAAACTTACAAATTCAACTTGG - Intronic
1189164835 X:38850399-38850421 CCAAATATACAAAATTAGCTGGG + Intergenic
1189440071 X:41027824-41027846 CAAAAAATACAAAATTAGCTGGG + Intergenic
1189452254 X:41147612-41147634 CTAAATATACAAAATTAGCTGGG - Intronic
1189466359 X:41280644-41280666 CAAAAAATAAAAAATCAGCTGGG - Intergenic
1189959353 X:46309621-46309643 CAAAATATAAAAACTCAGCCAGG + Intergenic
1189977744 X:46479266-46479288 AAAAATACACAAAATCAGCTGGG + Intronic
1190022552 X:46892383-46892405 AAAAATTTAAAAATTAAGCTGGG + Intronic
1190178465 X:48170887-48170909 CTAAAAATACAAATTTAGCTGGG + Intergenic
1190184970 X:48225669-48225691 CAAAAAATACAAAATTAGCTGGG - Intronic
1190190497 X:48273073-48273095 CAAAAAATACAAAGTTAGCTGGG - Intronic
1190192583 X:48289990-48290012 CAAAAAATACAAAATTAGCTGGG + Intergenic
1190197430 X:48331461-48331483 CTAAAAATACAAATTTAGCTGGG + Intergenic
1190197550 X:48332544-48332566 CAAAAAATACAAAATTAGCTGGG - Intergenic
1190307908 X:49096389-49096411 AAAAATAAACAAATTTAGCTGGG - Intronic
1190405623 X:50084540-50084562 AAAAATTCACAAAATCAGCTGGG - Intronic
1190533298 X:51402492-51402514 AAAAATACACAAATTTAGCTGGG + Intergenic
1190664170 X:52681872-52681894 CTAAAAGTACAGATTTAGCTGGG + Intronic
1190675252 X:52776550-52776572 CTAAAAGTACAGATTTAGCTGGG - Intronic
1190725594 X:53188534-53188556 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1190736552 X:53259207-53259229 AAAAAAGTACAAATCTAGCTGGG + Intronic
1190828694 X:54042139-54042161 CTAAAAATACAAAATCAGCTGGG + Intronic
1191191754 X:57675350-57675372 CAAAATGTACAAAGAAATCTTGG + Intergenic
1191246541 X:58232719-58232741 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1192062521 X:67842994-67843016 CAAAAAATACAAAATTAGCTGGG - Intergenic
1192110632 X:68360336-68360358 CAAAATTTTCAAAATTAGCTGGG - Intronic
1192236041 X:69296758-69296780 CTAAAAATACAAAATCAGCTGGG + Intergenic
1192348824 X:70337507-70337529 CAAAAAATACAAAATTAGCTAGG + Intronic
1192421514 X:71036210-71036232 TAAAAAGTACAAAATTAGCTGGG + Intergenic
1192474321 X:71426552-71426574 CTAAAAGTACAAAATTAGCTGGG + Intronic
1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG + Intergenic
1192729853 X:73792206-73792228 AAAAATGTAAAAGATCAGCTGGG + Intergenic
1193119002 X:77803920-77803942 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1193127804 X:77887969-77887991 CTAAAAGTACAAAATTAGCTGGG - Intronic
1193291285 X:79776422-79776444 CTAAATATACAAAATTAGCTCGG - Intergenic
1193530039 X:82645288-82645310 CAAAATGAACAAGGACAGCTTGG - Intergenic
1193660353 X:84249570-84249592 CAAAAAATACAAAATTAGCTGGG - Intergenic
1193729994 X:85091087-85091109 CAAAAAGTGCAAAATTAGCTAGG + Intronic
1193808737 X:86025514-86025536 GAAAATGTTCAAAGTTAGCTGGG + Intronic
1193850152 X:86527884-86527906 CAAAATGTTTGAATTCAGGTGGG - Intronic
1194004263 X:88470922-88470944 CAAAAGGTACAAAATCTGTTAGG + Intergenic
1194345564 X:92759936-92759958 CAAAATGTACAAAATGAGCCTGG - Intergenic
1194620916 X:96170360-96170382 ATAAATGAATAAATTCAGCTAGG - Intergenic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1195045241 X:101049630-101049652 AAAAATATACAAAATTAGCTGGG + Intronic
1195915674 X:109932802-109932824 AGAAATATAAAAATTCAGCTTGG + Intergenic
1195939067 X:110152347-110152369 AGAAAGGTAAAAATTCAGCTGGG - Intronic
1196288463 X:113911031-113911053 CTAAAAATACAAAATCAGCTGGG + Intergenic
1196365741 X:114921700-114921722 CAAAAAGTACAAAATTAGCTGGG - Intergenic
1196464325 X:115957800-115957822 CAAAATGTACAAACAAAGCAAGG - Intergenic
1196653455 X:118192665-118192687 AAAAATGAACAAAGTTAGCTGGG + Intergenic
1196653723 X:118195276-118195298 CAAAATGTACAAAAGCATATAGG + Intergenic
1196767032 X:119255736-119255758 CAAAAAGTACAAAATGAGCCAGG - Intergenic
1196824521 X:119730803-119730825 CTAAAAGTACAAAATTAGCTGGG - Intergenic
1197018434 X:121655992-121656014 CTAAATATACAAAATTAGCTGGG + Intergenic
1197129957 X:122993950-122993972 CAAAAAATTCAAAATCAGCTGGG + Intergenic
1197131292 X:123008410-123008432 CCAAATCTACAAACTCAGCCAGG - Intergenic
1197197232 X:123715197-123715219 CAAAATATACAAAATTAGCTGGG - Intronic
1197212262 X:123837821-123837843 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1197222510 X:123927276-123927298 CAAAAAATACAAAATTAGCTGGG + Intergenic
1197223888 X:123937702-123937724 CAAAAGGTAGCAATTCAGCCGGG + Intergenic
1197228313 X:123975757-123975779 CAAAAAGTACATATTCCGCAGGG - Intronic
1197338789 X:125241156-125241178 CAAAATTTACAAAATGGGCTGGG + Intergenic
1198186714 X:134260311-134260333 AAAAATTTAAAAAATCAGCTGGG - Intergenic
1198309261 X:135413861-135413883 CAAAATGTATAACATTAGCTAGG + Intergenic
1198464154 X:136889726-136889748 CTAAAAATACAAAATCAGCTGGG - Intergenic
1198470865 X:136945604-136945626 GAAAATTTACAAATTGTGCTTGG + Intergenic
1198584128 X:138100671-138100693 CTAAAAGTACAAAATTAGCTGGG + Intergenic
1198746399 X:139895429-139895451 CAAAAAATACAAAATTAGCTGGG - Intronic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1199342922 X:146703207-146703229 AAAAATGGGCAAAATCAGCTGGG - Intergenic
1199472930 X:148214795-148214817 CAAAATCTACAAATGCAGCAGGG + Intergenic
1199653592 X:149972510-149972532 AAAATTGGATAAATTCAGCTTGG + Intergenic
1199802676 X:151267156-151267178 CTAAAAATACAAAATCAGCTGGG - Intergenic
1200075843 X:153550176-153550198 CAAAGTGTACACCTTCAACTCGG + Exonic
1200131752 X:153852591-153852613 AAAAATGAACAAAATTAGCTGGG + Intergenic
1200140510 X:153900073-153900095 CTAAAAGTACAAAATTAGCTGGG + Intronic
1200243517 X:154510203-154510225 CAAAAAATACAAAATAAGCTGGG + Intronic
1200437487 Y:3169389-3169411 CAAAATGTACAAAGCAAGATTGG + Intergenic
1200653907 Y:5876587-5876609 CAATATGTACAAAATGAGCCTGG - Intergenic
1200767124 Y:7089627-7089649 CTAAATATACAAAATTAGCTGGG + Intronic
1200815002 Y:7522150-7522172 CAAAATACAAAAATTTAGCTGGG + Intergenic
1200840089 Y:7773010-7773032 AAAAATTTACAAAATTAGCTGGG - Intergenic
1201429015 Y:13886995-13887017 CAAAATATAAAAAATTAGCTGGG - Intergenic
1201894232 Y:18976693-18976715 CAAAAAATACAAAATCAGCAGGG + Intergenic
1202048652 Y:20758886-20758908 CTAAAAATACAAAATCAGCTGGG - Intronic
1202136843 Y:21675294-21675316 CCACATGTAAAAATTCAACTGGG + Intergenic