ID: 1098279888

View in Genome Browser
Species Human (GRCh38)
Location 12:68851857-68851879
Sequence TCATGACTTTAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098279888_1098279894 -9 Left 1098279888 12:68851857-68851879 CCTTCCCCCTTCTAAAGTCATGA 0: 1
1: 0
2: 1
3: 19
4: 198
Right 1098279894 12:68851871-68851893 AAGTCATGAGGAAAATATAAAGG 0: 1
1: 0
2: 3
3: 66
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098279888 Original CRISPR TCATGACTTTAGAAGGGGGA AGG (reversed) Exonic
902343169 1:15797854-15797876 TCATGTCTGGACAAGGGGGAGGG + Intergenic
902605671 1:17567943-17567965 TCTTGACTTTAAAAGAGGAAGGG + Intronic
902632633 1:17714502-17714524 TGAGGACTTTCGCAGGGGGAAGG - Intergenic
911239799 1:95452697-95452719 TGATGGCTTCAGGAGGGGGATGG - Intergenic
913127388 1:115805426-115805448 TCCTGTCTTGAGAAGAGGGAGGG + Intergenic
915246868 1:154561847-154561869 GAATGACTTAAGAAGGGGGCTGG + Intergenic
916377909 1:164176150-164176172 TCATGTCTTTTGAAGGGACATGG - Intergenic
920183907 1:204148955-204148977 TCATGACATTGGAGGGAGGAAGG + Intronic
920762628 1:208800181-208800203 TCATGTCGTTTGCAGGGGGAAGG + Intergenic
920829924 1:209455122-209455144 TCATGGCATGTGAAGGGGGATGG + Intergenic
922053817 1:222021272-222021294 TCATGAGTTTAGGAGACGGATGG - Intergenic
1062849736 10:735117-735139 TGAGGACTTGAGAAGGGGGAGGG + Intergenic
1062933983 10:1372298-1372320 TGAGGACTTGAGAAGGGGGAGGG + Intronic
1063745904 10:8881318-8881340 TCATGGCTCTAGCAGTGGGAGGG + Intergenic
1066073451 10:31846628-31846650 TCAAGACTTTATCAGGGGGAGGG + Intronic
1066471494 10:35702225-35702247 TGGGGACTCTAGAAGGGGGAGGG - Intergenic
1074709556 10:116166103-116166125 TCATGTCCTTTGAAGGGGCATGG - Intronic
1075608030 10:123830078-123830100 TTATGTGTTTAGAAGGGGTAAGG + Intronic
1078511369 11:11986547-11986569 TGAGGCCTTTGGAAGGGGGAGGG + Intronic
1080982395 11:37424068-37424090 TCATGACTTCAGAGGGTGCAAGG - Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1083953621 11:65970751-65970773 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953637 11:65970813-65970835 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953645 11:65970842-65970864 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953670 11:65970932-65970954 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953678 11:65970961-65970983 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953713 11:65971083-65971105 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953752 11:65971234-65971256 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953760 11:65971263-65971285 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953785 11:65971356-65971378 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953817 11:65971481-65971503 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953825 11:65971510-65971532 TCATGAGCTGAGGAGGGGGATGG + Intronic
1083953833 11:65971539-65971561 TCATGAGCTGAGGAGGGGGATGG + Intronic
1086671181 11:89549795-89549817 TCATGTCTTTTGCAGGGGCATGG - Intergenic
1090616388 11:128519343-128519365 TCATGAATTTGGGAGGGGGTGGG + Intronic
1090630804 11:128645642-128645664 TCATGACTCTTGAAGGGAGAGGG + Intergenic
1091975945 12:4825444-4825466 ACATTACTATAAAAGGGGGATGG - Intronic
1092509282 12:9136847-9136869 ACATGACTTTAAAATGGGCAAGG - Intergenic
1093221888 12:16431525-16431547 TCATGCCCTAAGAAGAGGGAGGG + Intronic
1097795433 12:63856378-63856400 TCCTGACTTTAGAGTGGGGAAGG - Intronic
1097879330 12:64672764-64672786 TCAGCACTTTGGAAGGCGGAGGG - Intronic
1098029373 12:66238435-66238457 TCATGGCTGTAGAAGGGAAAAGG + Intronic
1098279888 12:68851857-68851879 TCATGACTTTAGAAGGGGGAAGG - Exonic
1099578605 12:84411516-84411538 TCATGGCATCAGAAGGGTGAAGG - Intergenic
1099839692 12:87949896-87949918 TCATGTCTTTTGCAGGGGCATGG + Intergenic
1100005273 12:89888158-89888180 TCCTGACTTTTAATGGGGGAAGG + Intergenic
1100328261 12:93562034-93562056 TCATGACTTTTGCAGGGACATGG + Intergenic
1102625641 12:114233272-114233294 TCCTGAGTTTGGAAGGGAGAAGG - Intergenic
1103503112 12:121420509-121420531 TGATGAGTTTAGAGTGGGGAGGG + Intronic
1106902414 13:34367992-34368014 TCATGTCTTTTGTAGGGGCATGG + Intergenic
1107579163 13:41763789-41763811 TAATAACTTTAGAGGTGGGAAGG - Intronic
1107637957 13:42412076-42412098 TCATGACAAAAGAAGAGGGAAGG + Intergenic
1113738996 13:112698014-112698036 TCTTAACTTTAGCAGGGGCAGGG - Intronic
1114440963 14:22747352-22747374 TCATGACTTTCGCAGCGGGGAGG - Intergenic
1114915142 14:27254304-27254326 TCATGACTAGAGAAGGGGAGTGG + Intergenic
1115953138 14:38744422-38744444 TCATGGTTTTATAAGGGGGTGGG - Intergenic
1116244015 14:42384892-42384914 TCAAAACTTCAGAAGTGGGAGGG + Intergenic
1116569480 14:46497306-46497328 TCATGACTTTTGCAGGGACATGG - Intergenic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1117256214 14:53980726-53980748 TCATGAAGTTTGCAGGGGGAGGG + Intergenic
1117512356 14:56465796-56465818 TCATGACCCTTGAAGGTGGAAGG - Intergenic
1121675638 14:95750508-95750530 TTATGACTTCAGAGGGAGGAAGG + Intergenic
1121994742 14:98593236-98593258 GCAGGACTTTGGAAGGGAGAGGG - Intergenic
1124171848 15:27381330-27381352 TCATGCCTTCAGAAGGAGGAGGG - Intronic
1125301142 15:38253709-38253731 TCATAAGTTTAAAAGGGGGAGGG - Intronic
1126481086 15:49120979-49121001 TTAAGACTTTAGAAGTGGGCGGG - Intronic
1129561816 15:76578112-76578134 CTATGACTATAGAAAGGGGAGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130649335 15:85753314-85753336 TTATGACTTAATAATGGGGAGGG + Intergenic
1132072096 15:98787284-98787306 TCATGACTATATTAGGGGCATGG + Intronic
1135276452 16:21117369-21117391 GCAAGACTTAAGAAGGGAGATGG + Intronic
1135681834 16:24463894-24463916 TCAGAATCTTAGAAGGGGGATGG + Intergenic
1140079310 16:71729707-71729729 TCATGACTTTGGGAGTGGGTAGG - Intronic
1140646575 16:77038092-77038114 TTCTGCCTTTGGAAGGGGGAGGG - Intergenic
1142606994 17:1087504-1087526 GCAGGACTTTAAAAGGGGGCAGG + Intronic
1146198406 17:30832493-30832515 TCCTGACTTTGTAAGGGGAAAGG + Intronic
1148559294 17:48596864-48596886 TCTAGACTCTAGATGGGGGAGGG + Intronic
1152183420 17:78839938-78839960 AAGTGACTTTAGAAGGAGGAGGG - Intronic
1152553722 17:81042702-81042724 TCTTGACATTAGAATGGGGGTGG + Intronic
1152970903 18:159674-159696 TTATGGCTTTAGAAAGGGGTTGG - Intronic
1158294711 18:55983170-55983192 TCATGAGGTTAGGAGGGGCAGGG - Intergenic
1159069562 18:63608231-63608253 TCATGATTAGAGAAGGGGTATGG + Intergenic
1160246108 18:77161219-77161241 TCCAGACTTTAAAAGGCGGAGGG + Intergenic
1164755647 19:30686973-30686995 GGAGGACTTTAGAAGGGGGAGGG - Intronic
1165971336 19:39633286-39633308 TCATGTCTTTTGCAGGGAGATGG - Intergenic
1168355103 19:55695580-55695602 CCGTGGCATTAGAAGGGGGAGGG + Intronic
1168373528 19:55856394-55856416 TCATGACACTGGAAGGGGAAGGG - Intronic
929948942 2:46391453-46391475 TCATCGTTTTAAAAGGGGGAAGG + Intergenic
932060484 2:68493433-68493455 TTATGACTTTAGAGTAGGGAAGG + Intronic
932140631 2:69274151-69274173 TCTTGAATTTAGAAGTGGAAAGG - Intergenic
935437811 2:103055834-103055856 CCCTGACTCTAGAAAGGGGAGGG - Intergenic
936093746 2:109516616-109516638 TCATTACTGAAGAAGTGGGAAGG + Intergenic
936252158 2:110875256-110875278 TCTTGACTCTTGAAGAGGGAAGG + Intronic
938692295 2:133802707-133802729 TCATGCCTTTGAAAGGAGGAGGG + Intergenic
940009315 2:149038220-149038242 TCATTATTTAAAAAGGGGGAGGG + Intronic
940574263 2:155479622-155479644 TCATGTCTTTTGTAGGGGCATGG + Intergenic
941557532 2:167000537-167000559 ACATGGCTTTAGAAGTGGTATGG + Intronic
942268806 2:174253042-174253064 TAATAACTTTAGGAGGGGAAGGG + Intergenic
943905892 2:193501253-193501275 TCATGCCATTTGCAGGGGGAAGG - Intergenic
945370352 2:209008800-209008822 TGATGAATTTAGAACAGGGATGG - Intergenic
946136256 2:217649817-217649839 TTATGACTTTGGAATAGGGAAGG + Intronic
947911559 2:233804060-233804082 TCATCACCTTACAAGGGGGAGGG + Exonic
948338529 2:237230650-237230672 GCATGAGTTTGGAAGGGAGACGG - Intergenic
1170753398 20:19172654-19172676 TGATGGCTTTAGCAGGAGGAAGG + Intergenic
1171078122 20:22149677-22149699 TCCTGAGTTTACAAGTGGGAGGG - Intergenic
1173858677 20:46268077-46268099 TCATGCCTTTAGGCGGGTGAGGG - Intronic
1174246268 20:49183677-49183699 TCTGGACTTTAGAATGGGGATGG + Intronic
1174908599 20:54580084-54580106 TCATGTCTTTTGAAGGGACATGG - Intronic
1177200045 21:17944034-17944056 GCTTGACTTTAGAAGGATGATGG + Intronic
1177417199 21:20809163-20809185 TTATGACTTCAGAAGGGTTAAGG + Intergenic
1180672396 22:17563391-17563413 TCATGGCTGTAGAAGGGGGCTGG - Intergenic
1181342923 22:22197249-22197271 ACATGACCTTAGAAGGAAGAAGG - Intergenic
1181671664 22:24428144-24428166 TGATGAGTTTGGAAGGGGTATGG + Intronic
1183367808 22:37416570-37416592 TCATGACCACAGAAGTGGGAGGG + Intronic
1183450505 22:37892042-37892064 TGAAGACATTAGGAGGGGGATGG + Intergenic
1184021238 22:41822893-41822915 TCATGACTTTGGAAGATGGGGGG - Intronic
1185049140 22:48544631-48544653 TCAGGCCTTAAGAAGGGGGGTGG - Intronic
950198575 3:11026932-11026954 TCATGATTTTCAAAAGGGGAGGG + Intronic
951464062 3:22982973-22982995 TGATGTCTTTAAAAGGGGTAAGG - Intergenic
951575453 3:24108710-24108732 TCTTGACTATTGAAGGGAGAAGG - Intergenic
951685805 3:25342946-25342968 TCATGGTTTAAGAGGGGGGAGGG + Intronic
954785317 3:53088305-53088327 TCTTGACTTTGGAAGAGGGATGG - Intronic
957525293 3:81371892-81371914 TTATGACTTTGGAGGGTGGATGG - Intergenic
957628653 3:82688850-82688872 TGAGGACTATAAAAGGGGGAAGG + Intergenic
958095569 3:88939686-88939708 TCATGTCTTTTGAAGGGACATGG + Intergenic
958470908 3:94517829-94517851 TCATGTCTTTAGTCGGGGGGTGG + Intergenic
959120410 3:102225478-102225500 TCATCAGCTCAGAAGGGGGAAGG + Intronic
965152845 3:165004762-165004784 TCATGAATATAGACGGGAGAAGG + Intronic
967416456 3:189224140-189224162 TCAAGATTTTAAAAGGAGGAGGG + Intronic
968167738 3:196481269-196481291 TCCTGACCTTACAAGGGGAATGG + Intronic
970296537 4:14636877-14636899 TCATGTCTTTAAAAGTGAGATGG - Intergenic
970301602 4:14686704-14686726 AAATGACTTTAGCAGGGGAAGGG - Intergenic
971003039 4:22343574-22343596 TCAAGACTTTAGAGGGAGTATGG + Intergenic
971723086 4:30272405-30272427 TCATGTCTTTTGCAGGGAGATGG - Intergenic
972065177 4:34933813-34933835 TCATGTCTTTTGAAGGGGCATGG - Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
973024291 4:45248053-45248075 TCAGGATTTTAAAAGGGGAAGGG + Intergenic
973798228 4:54450491-54450513 TAGTGATTTTAAAAGGGGGAGGG - Intergenic
974745055 4:66061778-66061800 TCATGACTTAAGATGAGGCATGG - Intergenic
974890889 4:67880993-67881015 TAATGACTTTAGATTTGGGATGG + Intronic
975394033 4:73853965-73853987 AAATGGCATTAGAAGGGGGAGGG - Intronic
975405196 4:73981339-73981361 AAATGGCATTAGAAGGGGGAGGG + Intronic
975521497 4:75306626-75306648 TCATGACATTAGAACAGGTATGG - Intergenic
978474611 4:109111685-109111707 TAATGACTCTGGAAAGGGGAAGG - Intronic
978916899 4:114137780-114137802 TCCTGACATTACAAGGGAGAAGG - Intergenic
980548643 4:134303673-134303695 TCATGTCTTTAGCAGGAGCATGG - Intergenic
983174356 4:164570712-164570734 TCATGACTATTGAAGGAGGAGGG + Intergenic
988110372 5:26812413-26812435 CCATGATTTTTGAAGGTGGAAGG + Intergenic
988375653 5:30432053-30432075 TCATGACTCTACCAGAGGGATGG - Intergenic
988659152 5:33245950-33245972 TCAGCACTTTAGAAGGCTGAGGG - Intergenic
990540802 5:56770941-56770963 TCAGGACTTTAGTAGGGGGTGGG - Intergenic
996514454 5:124354545-124354567 TCATGACTGTAGTAGGAGAAAGG + Intergenic
997244204 5:132332380-132332402 CCATAACTTTAGGAGGGGGAAGG - Intronic
998905570 5:146900937-146900959 TCATGTCCTTTGCAGGGGGATGG - Intronic
999043222 5:148439173-148439195 TCATAACTAGAGATGGGGGAGGG + Intronic
999078657 5:148822604-148822626 TCATGTCTTTTGCAGGGGCATGG - Intergenic
1001683426 5:173575473-173575495 TCATGACAGGAGAGGGGGGATGG + Intergenic
1002572657 5:180152399-180152421 TCATGTCTTTTGAAGGGACATGG + Intronic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1006577683 6:35058139-35058161 TCCTGAGCTTGGAAGGGGGAGGG + Intronic
1006679883 6:35789238-35789260 TCAAGAAGTTAGAAGGGGAAGGG + Intronic
1007667571 6:43524421-43524443 ACATGATTTAAGAAGGGGGTTGG + Intronic
1008979451 6:57466126-57466148 TCATGTCTTTTGCAGGGAGATGG - Intronic
1009466579 6:63977893-63977915 TCAAGAATTTAGAGTGGGGAAGG - Intronic
1009757650 6:67960125-67960147 TCATAAATATAGAAGTGGGAAGG + Intergenic
1010611327 6:77957279-77957301 TCATTACTTTAGAAAGGAGTGGG + Intergenic
1012883464 6:104817991-104818013 TCATGACTTAACAAAGAGGAAGG + Intronic
1012982056 6:105841176-105841198 ACTTGACTTTAGAAGACGGATGG - Intergenic
1013163250 6:107566412-107566434 CCAAGACTTTAGAAAGGGAAGGG + Intronic
1013338295 6:109187660-109187682 TTATTACTTTAGAAGAGAGAGGG + Intergenic
1013659123 6:112276588-112276610 TCATGTCTTTTGAAGGGTAATGG - Intergenic
1014461556 6:121702907-121702929 TCATGTCTTTTTAAGGTGGAAGG - Intergenic
1015744350 6:136493929-136493951 TCATGTCTGTAAAATGGGGAAGG + Intronic
1016045275 6:139474478-139474500 TGAGAGCTTTAGAAGGGGGAAGG - Intergenic
1016699847 6:147041787-147041809 TCATGACTTTAGATGAGTAAAGG - Intergenic
1017177541 6:151518824-151518846 TAAGGACTTTAAAAGGGGAAGGG + Intronic
1017246448 6:152232217-152232239 TCATGACTTCAGAAATGGCATGG + Exonic
1017786571 6:157761822-157761844 TCAGGATTCAAGAAGGGGGAAGG + Intronic
1017949068 6:159120247-159120269 TCAAGACTTAAGAAGGGGAAGGG - Intergenic
1021286450 7:18786985-18787007 TTATGACCTTAAAAGAGGGAAGG - Intronic
1023388030 7:39680061-39680083 TCATAACCTTAGAGTGGGGAAGG - Intronic
1024757168 7:52547870-52547892 TGATGACTTTAAAAGTGGCAAGG - Intergenic
1025242864 7:57292580-57292602 TCATGTCTTCAGCAGGGGGTTGG - Intergenic
1025287453 7:57676567-57676589 TCATGTCTTTTGAAGGGACATGG + Intergenic
1026277925 7:68896400-68896422 TCAGGACTTCAGAAGAGAGAAGG - Intergenic
1026423245 7:70262437-70262459 TCAGGTCTTTAAAAGGCGGAGGG - Intronic
1026604093 7:71801118-71801140 TCATGTCTTTTGCAGGGGCATGG - Intronic
1028525839 7:91785653-91785675 TCATTACTGGAGAAGGGAGAAGG - Intronic
1028749994 7:94372388-94372410 GTATGTCTTTAGAAGGGGCAGGG - Intergenic
1033903865 7:146176913-146176935 TCATGCCTTCAGAAGGGGTCAGG + Intronic
1036111030 8:5902747-5902769 TGATGAGTTTAGAAAGAGGAAGG + Intergenic
1036551742 8:9821954-9821976 TCATGTCTTTAGCAGGGACATGG + Intergenic
1037176137 8:15948272-15948294 TCATGACTTTAGACTGGACATGG + Intergenic
1038298610 8:26320950-26320972 TCTTGACTTTGGGAGGAGGATGG + Intronic
1043669468 8:82863892-82863914 TTATTCTTTTAGAAGGGGGAAGG - Intergenic
1044630450 8:94273267-94273289 TTATGATTTTAGTAAGGGGAAGG - Intergenic
1046156416 8:110295803-110295825 TCATGTCTTTTGCAGGGGCATGG + Intergenic
1048319437 8:133386904-133386926 TCATTGCTTTGGAAGAGGGAGGG - Intergenic
1051158543 9:14179325-14179347 TCATTACTTTAGAAGGGGGTTGG - Intronic
1053367927 9:37537081-37537103 TCATGACTTTAGATTGGTCAGGG - Intronic
1056200231 9:84268462-84268484 TTATGACTTTAGAGTGGGGATGG + Intergenic
1056222656 9:84465580-84465602 TGATGACTTTGGAAGGGGGCTGG + Intergenic
1058818231 9:108704987-108705009 TCTTGACTTGAGCAGGGAGATGG + Intergenic
1059265664 9:113027585-113027607 AAATGACTATAGAAGGGGCATGG + Intergenic
1059582954 9:115572218-115572240 TCATTACTTGGGCAGGGGGAGGG - Intergenic
1060072553 9:120563099-120563121 TCATGAGTTGAGAAGGGAGTTGG + Intronic
1187877199 X:23814300-23814322 TCATGCCTTGAGGAGGGGAAGGG - Intergenic
1188240800 X:27786876-27786898 CCAGAACTTAAGAAGGGGGAGGG - Intergenic
1189620867 X:42835807-42835829 TCATGAATGTTGGAGGGGGATGG + Intergenic
1191115942 X:56852951-56852973 TCATGATTTTTGCAGGGGCATGG + Intergenic
1191959180 X:66680757-66680779 TCATGTCTTTTGCAGGGGCATGG - Intergenic
1193173282 X:78361692-78361714 TCATGCCTTTTGTAGGGGCATGG + Intergenic
1193835136 X:86334061-86334083 TCATGTCTTTTGAAGGGACATGG - Intronic
1195100393 X:101550213-101550235 TCATGACTTGTGATGGGGGGAGG + Intergenic
1196089237 X:111721868-111721890 ACATAGCTTTAGAAGTGGGAGGG + Intronic
1196140738 X:112260517-112260539 TAATGGTTTTAAAAGGGGGATGG + Intergenic
1197729728 X:129799247-129799269 TCCTGACTTGGGAGGGGGGAAGG - Intergenic
1199745514 X:150769849-150769871 TGATGACCACAGAAGGGGGAGGG + Intronic
1201273415 Y:12277514-12277536 TCATTACTTGAAATGGGGGAGGG - Intergenic