ID: 1098280268

View in Genome Browser
Species Human (GRCh38)
Location 12:68855331-68855353
Sequence GGTACCTGTGAGTCACATCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098280267_1098280268 -6 Left 1098280267 12:68855314-68855336 CCACATGATGGGTTGGAGGTACC 0: 1
1: 0
2: 1
3: 3
4: 67
Right 1098280268 12:68855331-68855353 GGTACCTGTGAGTCACATCCAGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098280268 Original CRISPR GGTACCTGTGAGTCACATCC AGG Exonic
902525119 1:17052313-17052335 GTTACCTGTGGGTAACATTCAGG - Intronic
902992590 1:20199573-20199595 GGTGCCTGTGACTCACACCTTGG - Intergenic
903825245 1:26140138-26140160 GCTCCCTGTGTTTCACATCCTGG - Intergenic
904320497 1:29695051-29695073 TGTACCTGAGAGTCCCATCCTGG + Intergenic
904344522 1:29859345-29859367 TGTACCTGTGAGGCACTGCCCGG + Intergenic
908745020 1:67367953-67367975 GGGACCTGTGTGTCACCCCCTGG - Exonic
908959115 1:69672888-69672910 GGTTCCTGTGAGTGACCTCCAGG + Intronic
908991094 1:70090726-70090748 CTTACCTTTGAGTCACAACCTGG + Intronic
912487648 1:110041712-110041734 GATACCTTTGTGTCACCTCCAGG + Exonic
912696850 1:111848478-111848500 GATACCTGAGAGTCACTTCAGGG - Intronic
913341662 1:117764008-117764030 GGTACCTGTGCGCAACATGCAGG + Intergenic
914076745 1:144359865-144359887 GGTACGTGTGCATCACATGCAGG + Intergenic
914102433 1:144606632-144606654 GGTACGTGTGCATCACATGCAGG - Intergenic
914296463 1:146330566-146330588 GGTACGTGTGCATCACATGCAGG + Intergenic
914526301 1:148469414-148469436 GGTACGTGTGCATCACATGCAGG + Intergenic
914640099 1:149597703-149597725 GGTACGTGTGCATCACATGCAGG - Intergenic
914805157 1:150986173-150986195 GGTACTTGTGCCTTACATCCTGG + Intronic
917160644 1:172053383-172053405 GGCCTCTGTGAGTCACTTCCTGG + Intronic
917968653 1:180193940-180193962 GGTGCCTGTCACTCACACCCAGG - Intronic
1063116985 10:3078751-3078773 GCTTCCTGTGAGAAACATCCAGG + Intronic
1065115211 10:22477417-22477439 GGTGCCTTTGGGTCACACCCGGG - Intergenic
1065209267 10:23387417-23387439 GGTACCTGTGAACAACATGCAGG + Intergenic
1065509962 10:26468793-26468815 GGTTCCTGTGAGACACATCCAGG - Intronic
1067832346 10:49617393-49617415 AGTTCATGTGAGTCAGATCCTGG - Intronic
1070398449 10:76032636-76032658 GGTACCTGTGTGTGAGATCCTGG + Intronic
1073071134 10:100793865-100793887 AGCTCCTGAGAGTCACATCCCGG - Intronic
1073639253 10:105233439-105233461 GGTACATGTGAAGAACATCCAGG + Intronic
1076723158 10:132401535-132401557 GTTACCTGTGGGTCACAGCCAGG + Intronic
1078017811 11:7630254-7630276 GTGACCAGTCAGTCACATCCTGG - Intronic
1078129407 11:8600988-8601010 AGTATGTGTGAGTCCCATCCGGG + Intergenic
1079205066 11:18407646-18407668 TTTCCCAGTGAGTCACATCCTGG + Exonic
1084470138 11:69354533-69354555 GGTACCTGGGAGTGACTTGCTGG - Intronic
1084695327 11:70750196-70750218 GCTACCTTTGAGTCCCAGCCAGG - Intronic
1084703154 11:70800739-70800761 GGAAACTGTGAGGCACATCCCGG - Intronic
1085857378 11:80190648-80190670 GGTACCTCCAAGTCACCTCCTGG + Intergenic
1086873275 11:92064932-92064954 GGAACCTGTGTGTCAGAGCCAGG - Intergenic
1089422560 11:118342677-118342699 GGTACCTGTGAGTCAGCTAGGGG - Exonic
1090015430 11:123081964-123081986 GGTAGCTGTGATTGAAATCCAGG + Intronic
1091154001 11:133356790-133356812 GGAACCTCAGAGTCTCATCCAGG + Intronic
1093528152 12:20128634-20128656 GGTACATGTGCGTAACATGCAGG + Intergenic
1093625550 12:21342983-21343005 ATGACCTGTGCGTCACATCCAGG + Intronic
1094102044 12:26775124-26775146 GGTACCTGTGGATCAGACCCTGG - Intronic
1097231857 12:57517279-57517301 GGTACCTATGTTTCACCTCCTGG - Exonic
1098280268 12:68855331-68855353 GGTACCTGTGAGTCACATCCAGG + Exonic
1103090620 12:118095554-118095576 GGAACCACTGAGTCACATTCAGG + Exonic
1104896900 12:132169083-132169105 GGCACGTGGGAGTCACACCCAGG - Intergenic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1113852650 13:113426564-113426586 GGTGCCTGTGAGCCTCGTCCAGG - Intronic
1115598971 14:34937554-34937576 AGTCCCTGTGAATCCCATCCAGG - Intergenic
1116873139 14:50086487-50086509 GGTGCCTGAGACTCACATCTAGG - Intronic
1118613174 14:67557155-67557177 TGTGCCTGGGAGTCACAGCCTGG + Intronic
1125899369 15:43330614-43330636 GGCACTTGTGCGTCACTTCCGGG + Intergenic
1129755853 15:78098551-78098573 GGTTCCGGGGACTCACATCCAGG - Exonic
1130664510 15:85858573-85858595 TGAACCTGTGGGTCACACCCTGG + Intergenic
1132497692 16:271470-271492 GGGGCCTGTGAGTCAGGTCCCGG + Intronic
1134213257 16:12295574-12295596 GGAACCTGTGAGTCACTCCAAGG - Intronic
1136652295 16:31683220-31683242 AGTAACTGGGAGTCACACCCAGG - Intergenic
1138077574 16:54057799-54057821 GGTAGATGTGAGTCATACCCTGG + Intronic
1141400695 16:83744607-83744629 GGACCGTGTGAGTCACATCAGGG + Intronic
1145975940 17:28984441-28984463 GGTACCTGTGTGACTCTTCCTGG + Intronic
1147600118 17:41740121-41740143 GGGATCTGTGGCTCACATCCTGG - Intergenic
1152646194 17:81469571-81469593 GCCACCTGTGAGCCTCATCCTGG - Intergenic
1156267815 18:35504124-35504146 GGGACCTGTGAGAAACCTCCTGG + Intergenic
1158236165 18:55316986-55317008 GGTATCTGTGAATCTCATGCAGG + Intronic
1162451316 19:10756878-10756900 GGTTCATGTGAGTGACATCAGGG - Intronic
1165147116 19:33737862-33737884 GATAACAGTGAGTCACAGCCTGG - Intronic
926615661 2:14994584-14994606 GGTTCCCGAGAGTCACAGCCTGG + Intergenic
926918234 2:17914020-17914042 GGGACCTGTGAGTACCCTCCTGG - Intronic
933612778 2:84454725-84454747 TGTACCTGTCAGCCACATACTGG + Intronic
934950244 2:98570996-98571018 GGTCCCTGTGTGCCACAGCCAGG + Intronic
935181195 2:100692572-100692594 GGTCACAGTGAGTCACATCCTGG - Intergenic
936079566 2:109423147-109423169 GGGACCTGGGAGTCCTATCCAGG + Intronic
936578224 2:113672865-113672887 GGCACATGTAAGACACATCCTGG - Intergenic
938200386 2:129367847-129367869 GCTAGCTGTGAGTCAGATGCGGG + Intergenic
943711475 2:191100409-191100431 TGTACCTGCAAGTCAAATCCAGG - Intronic
944021343 2:195108362-195108384 GGTATGTGTGATTCACATGCAGG - Intergenic
947261218 2:228224601-228224623 CCTACTTGTGACTCACATCCAGG - Intergenic
948217640 2:236243608-236243630 GGTACCTGTGAGTTTCTTCCAGG + Intronic
1175354799 20:58355856-58355878 GGTACCTGCTATTTACATCCAGG - Intronic
1175478958 20:59298303-59298325 GGTGCCTGAGAGGCTCATCCAGG + Intergenic
1175720973 20:61287132-61287154 GGCTGCTGTGAGTCTCATCCTGG - Intronic
1180072569 21:45443652-45443674 TGTACCTGTCTGTCACATCCCGG + Intronic
1180181993 21:46122152-46122174 AGCACCCGTGAGTCACAGCCTGG + Exonic
1182661978 22:31931651-31931673 GGTATGTCTCAGTCACATCCGGG - Intergenic
951868060 3:27329458-27329480 AGTAACTGACAGTCACATCCTGG - Intronic
956343880 3:68256516-68256538 GGCACCTGAGAGTAACATCCTGG - Intronic
962475552 3:135752142-135752164 GGTCTCTGTGGGTCACAACCAGG + Intergenic
963429843 3:145186023-145186045 GATGCCTTTGAGTCACATCAGGG + Intergenic
967125816 3:186423641-186423663 GGAAGCTGTGAGCCAAATCCTGG + Intergenic
970713836 4:18896918-18896940 TGTACCTGGGATTCAAATCCAGG + Intergenic
971958834 4:33457887-33457909 GGTACCTGTGCACAACATCCAGG - Intergenic
985976543 5:3422694-3422716 GGCACCTGAGAGTCACTTCTGGG + Intergenic
986212525 5:5687561-5687583 GGTAGCTGTAAGTCACACACGGG + Intergenic
988348275 5:30069196-30069218 GGTACATGGGAGTCCCATGCAGG - Intergenic
991716675 5:69457374-69457396 GATACCTGTGTGTCACATATGGG + Intergenic
991731090 5:69588976-69588998 GATACCTGTGTGTCACATATGGG + Intronic
991807522 5:70444135-70444157 GATACCTGTGTGTCACATATGGG + Intergenic
991863860 5:71038876-71038898 GATACCTGTGTGTCACATATGGG - Intronic
992194844 5:74328794-74328816 GGGAGCTGAGAGTCAGATCCAGG + Intergenic
993549881 5:89260260-89260282 GGGACCTGTGAGTGAGATACTGG - Intergenic
995127036 5:108588468-108588490 GGTTCCTGTGACTTACATCTAGG + Intergenic
999685338 5:154097705-154097727 GCTACCTGTTGGGCACATCCAGG + Intronic
1000120210 5:158189930-158189952 GGGACCCATGAGTCTCATCCTGG + Intergenic
1006738824 6:36293176-36293198 GGTCCCTGTGACTCACACCTGGG + Intronic
1016361152 6:143268775-143268797 GGGACCTGTGTGGCACATCCTGG - Intronic
1016556144 6:145340863-145340885 GGGCCCTGTGAGTCTCTTCCAGG - Intergenic
1017017980 6:150116764-150116786 GGTGGCTCTGAGTCACAACCAGG + Intergenic
1017798892 6:157874058-157874080 GGTACCTTTGGTTCACCTCCAGG + Intronic
1018683298 6:166282621-166282643 GGAACCTGTGAGTCAGACGCAGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1024258391 7:47556646-47556668 GGTACATCTGAGTCACACTCTGG + Intronic
1024615448 7:51108066-51108088 GGTGCCTCTAAGTCAGATCCAGG + Intronic
1025161158 7:56662158-56662180 TGTTTCTGTGAGTGACATCCAGG - Intergenic
1025186613 7:56865246-56865268 GGCACCTGTGAGTCAGGTGCAGG - Intergenic
1025685309 7:63711666-63711688 GGCACCTGTGAGTCAGGTGCAGG + Intergenic
1025734623 7:64136102-64136124 GGGACCTGTGATTCACACCCAGG + Intronic
1025905655 7:65782591-65782613 GTTACCTGTGAGTCAGGTGCGGG + Intergenic
1026185563 7:68080281-68080303 GCTACCAGGGAGTCTCATCCTGG - Intergenic
1034192384 7:149222296-149222318 GGGACATGTGAGTCCCACCCTGG - Intronic
1038841489 8:31188634-31188656 GGTACCTGTGGGTGCCATCACGG + Intergenic
1043175331 8:77017767-77017789 AATACCTGTGAGTCATATTCAGG - Intergenic
1044457390 8:92403919-92403941 AGAACCTGTGAGTGACCTCCAGG - Intergenic
1046746026 8:117877014-117877036 GTTAGCTTTGAGGCACATCCAGG - Intronic
1053527882 9:38847902-38847924 GGTAGCTGTGTGCCATATCCAGG + Intergenic
1054200103 9:62072338-62072360 GGTAGCTGTGTGCCATATCCAGG + Intergenic
1054638252 9:67516022-67516044 GGTAGCTGTGTGCCATATCCAGG - Intergenic
1056621444 9:88217974-88217996 TGTGTCTGTGAGTCACCTCCAGG - Intergenic
1060152051 9:121295139-121295161 AGCTCCTGTGCGTCACATCCTGG + Intronic
1061346539 9:130030807-130030829 GGTTAGTGTGAGTCACCTCCAGG + Intronic
1189438030 X:41009999-41010021 AATACCTGTGAGTCACAGCCAGG + Intergenic
1194406663 X:93504488-93504510 GGTACGTGTGAGTAATATGCAGG + Intergenic