ID: 1098282060

View in Genome Browser
Species Human (GRCh38)
Location 12:68871714-68871736
Sequence GGCTCCCGACAGGCACCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098282060 Original CRISPR GGCTCCCGACAGGCACCTGT TGG (reversed) Intronic
900353337 1:2247765-2247787 TGCTCCCCAAGGGCACCTGTGGG - Intronic
901040341 1:6359558-6359580 GGCTGCCGGCTGCCACCTGTGGG + Intronic
901627075 1:10630463-10630485 GGCTGGGGACAGGCACCTGACGG - Exonic
902536616 1:17122545-17122567 GGCTGCCCACAGGCTGCTGTGGG + Intergenic
906656028 1:47548941-47548963 TGCTGCTGACAGGCAGCTGTTGG - Intergenic
908950974 1:69562296-69562318 TGCCCCTGACAGGCCCCTGTGGG - Intergenic
909820080 1:80050949-80050971 GGCGCCCAACCGGCACCTGGAGG - Intergenic
920013645 1:202888566-202888588 GGCGGCCGAGAGGCACCTGCCGG + Intronic
920701100 1:208218715-208218737 GGCTCCGGAATGGCACATGTGGG - Intronic
922677868 1:227563798-227563820 GAGTCCCGGCTGGCACCTGTGGG + Intronic
922750293 1:228067082-228067104 GGCTCCCCATGGGCACCTGAGGG - Intergenic
1067299477 10:44995773-44995795 AGCTCCCCACAGGAACCAGTAGG - Exonic
1068853136 10:61767773-61767795 GTCTCTCCACTGGCACCTGTGGG + Intergenic
1070761529 10:79027234-79027256 GTCTCCCAACACCCACCTGTGGG - Intergenic
1070789731 10:79181883-79181905 GGCTCCCCACCGGCAGCTGAGGG + Intronic
1074162202 10:110844467-110844489 AGCTCCCCACAGGCCCATGTGGG - Intergenic
1076001784 10:126918351-126918373 GGCTACCGCCACGCACCAGTAGG - Intronic
1076482328 10:130792711-130792733 TGCTCCGGCCAGGCTCCTGTAGG + Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076759495 10:132594777-132594799 AGCTCCAGGCAGGCAGCTGTGGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077332702 11:1990376-1990398 GGCTCCCCACAGTCACCCCTGGG + Intergenic
1078387478 11:10905183-10905205 GGCTACCCAGAGGCAGCTGTTGG + Intergenic
1083425341 11:62581527-62581549 GGCCCCCGACAGTCACCAGCTGG - Exonic
1084472392 11:69370685-69370707 GGCTCCTGACAGTTTCCTGTGGG + Intergenic
1089620198 11:119717750-119717772 GGAGCCCGGCAGGCACCTGCAGG + Intronic
1090784961 11:130040784-130040806 GGCTTTCCACAGGCACCTGCAGG - Intergenic
1202815685 11_KI270721v1_random:45552-45574 GGCTCCCCACAGTCACCCCTGGG + Intergenic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1102246700 12:111361013-111361035 TGCTCTCCACAGGCACCTCTGGG - Exonic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114494145 14:23121033-23121055 GGCTCTCGGCAGGCTCCTGCGGG + Intergenic
1115006692 14:28494257-28494279 GGCTCCAACCAGGAACCTGTTGG + Intergenic
1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG + Intronic
1122322918 14:100866372-100866394 GGCTGCTGATAGGCAGCTGTAGG - Intergenic
1122780207 14:104140282-104140304 GGCTCAGGCCAGGCGCCTGTGGG + Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1124988598 15:34648199-34648221 TGCTACAGACAGTCACCTGTAGG - Intergenic
1125765263 15:42131259-42131281 GGCTCCCCAGATGCACCTGCAGG - Intergenic
1128328693 15:66741838-66741860 GCCTCAGGACATGCACCTGTAGG - Intronic
1130859887 15:87876400-87876422 AGCTCACCACAGGCACATGTGGG - Intronic
1136229053 16:28876435-28876457 GTCTCCCCACCGGCACCTGGAGG - Intergenic
1137261159 16:46831068-46831090 GGCCCCCGGCACCCACCTGTTGG + Exonic
1142227808 16:88885950-88885972 GACGCCCGACAGGTACCTGTGGG - Exonic
1142643590 17:1298827-1298849 CTCCCCCGGCAGGCACCTGTGGG + Exonic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1149391757 17:56198529-56198551 GGCTGCAGACTGGTACCTGTTGG - Intronic
1152219061 17:79050938-79050960 GGTTCCCTCCAGGCACCTCTGGG - Intergenic
1152987336 18:332701-332723 GGCTGCCACCAGGCACCTGTGGG - Intronic
1161839445 19:6670157-6670179 CGCTGCGGACAGGCACCCGTGGG + Exonic
1163472625 19:17506164-17506186 GGCTCCCAGCAGGCACCAGACGG - Exonic
1163611579 19:18304543-18304565 GGCCCCCGAGAGGCAGCTGTGGG - Intergenic
1166185590 19:41136880-41136902 GCCGCGCGCCAGGCACCTGTTGG - Intergenic
1167034454 19:46985972-46985994 GGCTTCCGAGAGCCACGTGTTGG - Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
925855043 2:8121408-8121430 GGCTCCCTTCAGGCAGCTGAAGG - Intergenic
930018084 2:46984544-46984566 GCCCCCCGACAGCCACCTCTAGG + Intronic
933274204 2:80266411-80266433 GGCTCCCTTCAGACGCCTGTGGG + Intronic
948473928 2:238204178-238204200 CGCTCCCCACAGACACCAGTGGG - Intergenic
948562812 2:238865398-238865420 GGATCCAGCCGGGCACCTGTTGG + Intronic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1171321969 20:24254180-24254202 GGTTCCCACCAGGCACATGTGGG + Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172025435 20:31945287-31945309 GGCTCACCACAGCCATCTGTGGG - Exonic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1173793345 20:45841941-45841963 AGCCCCCGAGAGCCACCTGTGGG + Exonic
1176411227 21:6450574-6450596 TGCTCCCGACCATCACCTGTGGG - Intergenic
1179279818 21:39924932-39924954 GGGTCCCCACAGGCTCCTCTGGG + Intronic
1179686720 21:43058896-43058918 TGCTCCCGACCATCACCTGTGGG - Exonic
1179790244 21:43752266-43752288 GGCCCTCGCCAGTCACCTGTGGG + Intronic
1180001928 21:44998995-44999017 GGCTCCTGACAGATTCCTGTGGG - Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1181409605 22:22709898-22709920 CGCTCCCCACAGGCAGCTGGAGG + Intergenic
1181417068 22:22768079-22768101 CGCTCCCGACAGGCAGCTGGAGG + Intronic
1182424888 22:30266698-30266720 TGCTCCCCACCGGCACCCGTGGG + Intronic
1182477203 22:30582789-30582811 GGCCCCTGACAGGCACATCTGGG + Intronic
1182492538 22:30683030-30683052 GGTTCCCAACAGGCACATGCTGG - Intergenic
1183688979 22:39377503-39377525 GGGGCCGGGCAGGCACCTGTTGG - Intronic
1184417605 22:44361323-44361345 GGCTCCCGACTGGCACCGTCAGG + Intergenic
952751941 3:36831743-36831765 GGTTCCCGAGAGGCTCCTGAAGG - Exonic
956877640 3:73479493-73479515 AGCTCAGGCCAGGCACCTGTCGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
959887462 3:111519243-111519265 GGCATCTGACAGGCTCCTGTTGG + Intronic
968509756 4:990385-990407 GGCTCCCGCCAGGCGCCTGCTGG - Intronic
968621598 4:1605717-1605739 GGCTGCCCAGAGGCACCTGCAGG + Intergenic
968642790 4:1722634-1722656 GGAACCCCACAGGCACCTGGTGG - Intronic
969017657 4:4115320-4115342 GGCTCCCACCATGCAGCTGTGGG - Intergenic
969724606 4:8911792-8911814 AGCTGCCCACGGGCACCTGTGGG - Intergenic
969795531 4:9524854-9524876 GGCTCCCACCATGCAGCTGTGGG + Intergenic
977067233 4:92333365-92333387 GTTTCCAGAAAGGCACCTGTGGG - Intronic
977819795 4:101458399-101458421 GGCAACCCAAAGGCACCTGTAGG - Intronic
981269379 4:142826947-142826969 GGCTACCGAAAGGCACCAATAGG - Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985686817 5:1285892-1285914 GGCTCACGTCATGCTCCTGTTGG + Intronic
987842592 5:23239892-23239914 GTCTCCCAACATTCACCTGTTGG + Intergenic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
990595046 5:57304136-57304158 GGCCCCAGACAGGAGCCTGTAGG - Intergenic
992791826 5:80220728-80220750 GGCTCCAGACAGGAAACTGAGGG + Intronic
1000064476 5:157683144-157683166 GGTTCCCAACAGGCACATGCTGG - Intergenic
1001835964 5:174832739-174832761 GGCTCTCCACAAGCTCCTGTTGG + Intergenic
1002649175 5:180679294-180679316 GGCTCTCCAAGGGCACCTGTGGG + Intergenic
1003136395 6:3437968-3437990 AGCCCCAGACAGGCTCCTGTGGG + Intronic
1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG + Intronic
1007345957 6:41229554-41229576 GGCTCCCAACAAGCACAGGTAGG + Exonic
1007363822 6:41376088-41376110 GGCTCGCGCCAGGCTCCTGGCGG + Intergenic
1013803852 6:113975416-113975438 GGCTCCCCACAGTCATCTGAGGG - Intronic
1015163179 6:130175337-130175359 AGCTCCCGACAGCCACTTCTGGG + Intronic
1017766800 6:157613585-157613607 GCCACACGATAGGCACCTGTTGG + Intronic
1025725508 7:64054397-64054419 GGCTCCCTACAGGCACATAGAGG + Intronic
1026598218 7:71752229-71752251 GGCTCGGGACAGGCAGGTGTGGG + Intergenic
1027029045 7:74875022-74875044 GGCTCCCGGCAGGCCCGGGTGGG - Intergenic
1032562840 7:132910390-132910412 GGCTCCTGACAGACACAAGTAGG + Intronic
1039454583 8:37698349-37698371 GGCTCCCGGCAGGGCCGTGTGGG - Exonic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1043426545 8:80153837-80153859 GGCTCCCGCCAAGCATCTATGGG - Intronic
1045938515 8:107711102-107711124 GCATGCTGACAGGCACCTGTAGG - Intergenic
1048005210 8:130413932-130413954 GGCTCCTCATAGGCAACTGTTGG - Intronic
1049164111 8:141116165-141116187 GCCGCATGACAGGCACCTGTGGG - Intergenic
1049428860 8:142549989-142550011 GGCTCTCAGCTGGCACCTGTGGG - Intergenic
1049476599 8:142799799-142799821 GGCGCTCGACGGGCAGCTGTTGG + Intergenic
1049743932 8:144255072-144255094 GCCACCCCACAGGCACCTGGAGG + Intronic
1050131276 9:2415222-2415244 GGCCACAGACAGGTACCTGTTGG - Intergenic
1052032559 9:23645103-23645125 GGCTCCTGACTGGCACGAGTTGG - Intergenic
1053356962 9:37454340-37454362 GGCTTCAGACAGGCAGCTTTGGG - Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1060523493 9:124307801-124307823 GGCTGACGACGTGCACCTGTGGG - Intronic
1062568810 9:137175170-137175192 AGCCCCCGTCAGGCACCTGCAGG + Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185599320 X:1328014-1328036 GGGTCCTTGCAGGCACCTGTGGG + Intergenic
1186110090 X:6246469-6246491 GCTTCCCAACAGGGACCTGTAGG + Intergenic
1186445956 X:9628984-9629006 GGTTGCCCTCAGGCACCTGTGGG + Intronic
1190381735 X:49845718-49845740 GGCTCCCGAGAGCCAATTGTGGG - Intergenic
1190727756 X:53201729-53201751 GGCGCCCAGCAGGCAACTGTGGG + Exonic
1191141230 X:57118637-57118659 GACCCCTCACAGGCACCTGTTGG - Intronic
1191142834 X:57134361-57134383 GACCCCTCACAGGCACCTGTTGG - Intergenic
1197587567 X:128367978-128368000 GACTGCCAACAGGCACCTTTGGG + Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic