ID: 1098283015

View in Genome Browser
Species Human (GRCh38)
Location 12:68880445-68880467
Sequence AAGAGTAACAAGCTCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098283015_1098283018 14 Left 1098283015 12:68880445-68880467 CCCTCCAAGAGCTTGTTACTCTT 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1098283018 12:68880482-68880504 GCCCAAATCCTCTCACCAAATGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098283015 Original CRISPR AAGAGTAACAAGCTCTTGGA GGG (reversed) Intronic
905108238 1:35576716-35576738 GAGAGAAACCAGCTCTGGGAGGG - Intronic
906773725 1:48509581-48509603 AGGAGTATCCAGCTCTTTGAGGG + Intergenic
906804723 1:48769596-48769618 TAGAGGAACGAGCACTTGGAAGG - Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
908571715 1:65418320-65418342 TAGGGAAACAAGCTCTTGTAGGG + Intergenic
910886833 1:91972650-91972672 AAGAATAAAAAGCTCTGTGAGGG - Intronic
914356545 1:146890018-146890040 AAGAGAAACAAGATACTGGAAGG + Intergenic
914427833 1:147594956-147594978 AAGAGTAAGAAGCCAATGGATGG + Intronic
917019070 1:170566788-170566810 AAGAATTACAAGCTAGTGGATGG - Intergenic
917103169 1:171465980-171466002 AAAAATAACAGGCTCTTGGCAGG + Intergenic
919424333 1:197410956-197410978 AACAGTAAGAAGCCTTTGGATGG - Intronic
920814751 1:209320739-209320761 AAGATTAATAAGCTCCTGGCAGG - Intergenic
923889024 1:238190529-238190551 AAGAGGAAGAAACACTTGGAAGG + Intergenic
924281187 1:242438931-242438953 AAGAGTAACAAGCTGGGGAAGGG - Intronic
1072008953 10:91286856-91286878 AGGAAGAACAAGCTTTTGGAAGG - Intergenic
1072285236 10:93908233-93908255 AAGATTAAGAAGCTCTTGGCTGG - Intronic
1072531472 10:96323521-96323543 ATGAGTGACAGACTCTTGGAGGG - Intronic
1076886276 10:133264034-133264056 AAAGGAAAAAAGCTCTTGGAGGG - Intronic
1077521268 11:3036517-3036539 AAGAATAACAAGCTTTGGCAAGG + Intronic
1081457051 11:43233880-43233902 AAGAGTCACAGGCACTTTGATGG + Intergenic
1088959630 11:114650165-114650187 AAGAGGAACAAGCCCTTTCAGGG + Intergenic
1089062353 11:115635874-115635896 AAAAGTCATAAGGTCTTGGAGGG - Intergenic
1089417784 11:118306908-118306930 AAGAAAAACACGCTCTTGGTTGG - Intronic
1090229646 11:125092426-125092448 AAGGGAAAGAAGCTCTTGGTCGG + Intergenic
1090730166 11:129566005-129566027 AATAGTAACAAGATATTAGAGGG + Intergenic
1091524329 12:1282725-1282747 AAAGGTAACAAGCTCTTGAGTGG - Intronic
1091681752 12:2532500-2532522 AAGAGTAACAACTACCTGGATGG - Intronic
1092041706 12:5390731-5390753 AAGAGTAACATGCTAGTGGCAGG - Intergenic
1094446289 12:30534111-30534133 ACCAGCAACAAGCACTTGGAAGG - Intergenic
1098283015 12:68880445-68880467 AAGAGTAACAAGCTCTTGGAGGG - Intronic
1098721184 12:73900326-73900348 AAGTGTAAAAATCACTTGGAGGG - Intergenic
1099620120 12:84992714-84992736 AGGAGTTCCATGCTCTTGGATGG - Intergenic
1100566868 12:95804244-95804266 AAGAGAAAAAAGTTCTTGGTAGG - Intronic
1111169510 13:84507618-84507640 AAGAGTTACATGCTGTTGGTGGG - Intergenic
1112892226 13:104251821-104251843 AAGAGAAAAAAGATCATGGAAGG + Intergenic
1115268423 14:31525933-31525955 ACCAGTAATAAGCTCTTTGAAGG + Intronic
1116057112 14:39877157-39877179 AATATTAACCAGCTCTTGGTGGG - Intergenic
1116842972 14:49838379-49838401 AAGATTAACAGGTTCTTGAATGG + Intronic
1118427060 14:65677037-65677059 CTGAGTAACAACCTTTTGGAGGG - Intronic
1118563590 14:67114967-67114989 AAGAGTAATAAGCTCTGTGGGGG - Intronic
1118566068 14:67142486-67142508 AAGTGCAACAGGCTCTTTGATGG - Intronic
1123663301 15:22585816-22585838 AAGAATAACAATCTTTTGGCCGG + Intergenic
1124317131 15:28680254-28680276 AAGAATAACAATCTTTTGGCCGG + Intergenic
1124566315 15:30817227-30817249 AAGAATAACAATCTTTTGGCCGG - Intergenic
1127056080 15:55133639-55133661 AAGAGTAACAAGCTAATCCAAGG - Intergenic
1128840264 15:70844797-70844819 AAGAGTAGGAAGCTCTTAGAAGG - Intronic
1129423446 15:75448641-75448663 AAGCTTAACAAACTCTTGGCTGG + Intronic
1131223739 15:90607071-90607093 AAGAATAGGAAGCTCTTAGACGG + Intronic
1131497461 15:92925295-92925317 ATGAGTAATAAGCTTTTGGAGGG - Intronic
1133051062 16:3117751-3117773 AGGAGTCAAAAGCTCTGGGATGG - Intronic
1135917085 16:26614865-26614887 AAGAGCAACAGGCTCTTTCACGG + Intergenic
1136586272 16:31187373-31187395 AATAGAAACTAGCTCTGGGAAGG + Intronic
1139977470 16:70825435-70825457 AAGAGAAACAAGATACTGGAAGG - Intronic
1203126308 16_KI270728v1_random:1586829-1586851 AAGAGAAACAAACTCTTAGTTGG - Intergenic
1143820992 17:9562813-9562835 AAGAGTGACAACCCCTTTGAGGG + Intronic
1144296289 17:13878145-13878167 AAGAGTACCAAGCCTTTGTAAGG - Intergenic
1146373182 17:32277911-32277933 AAGTGGAAAAACCTCTTGGAGGG - Intronic
1147862693 17:43532988-43533010 AGGAGTAACAGGCTCGAGGAAGG - Intronic
1148843535 17:50514895-50514917 AAGAGTTGCAAGATCTTGGGAGG - Intronic
1150248020 17:63690583-63690605 AAGAGCACCAAGCACCTGGAGGG + Intronic
1150932386 17:69599275-69599297 AAGATTAAGAAGATCTTGGAAGG - Intergenic
1151090309 17:71431960-71431982 AAGTTTCACAATCTCTTGGATGG + Intergenic
1153538154 18:6125357-6125379 AACAGGAAAAGGCTCTTGGATGG + Intronic
1156618215 18:38814328-38814350 AAGAATACCTAGATCTTGGAAGG - Intergenic
1157473863 18:48009164-48009186 AAGAGTTCCTACCTCTTGGATGG - Intergenic
1159619787 18:70623712-70623734 AAGAGGAACTAGCCCTTGAATGG - Intergenic
1159793511 18:72813925-72813947 AAGAGTAACACACTCATGAAAGG + Intronic
1160481475 18:79244457-79244479 AAGAGTTCAAAGCTCTTTGAAGG + Intronic
1163889751 19:20000299-20000321 GAGAGTAACATGCTCTTCCATGG + Intronic
1165527445 19:36368171-36368193 AAGAGAAACAAGCTCTGGCCGGG + Intronic
1167412310 19:49352010-49352032 AAGAGAAACCAAGTCTTGGAAGG + Intronic
925502118 2:4516627-4516649 GGGAGGAACAAGCTCATGGAGGG - Intergenic
927293517 2:21427404-21427426 TAGGGTAACAAGCTGTTGGCAGG + Intergenic
927940802 2:27101727-27101749 AGGAGCCACAAGCTGTTGGAAGG - Exonic
930055978 2:47252350-47252372 AAAGGTAACATGCTCTTGTAAGG + Intergenic
930270757 2:49253669-49253691 AAGACTAATAAAGTCTTGGATGG + Intergenic
931166533 2:59754968-59754990 AAGAGTGAGAACTTCTTGGATGG - Intergenic
931525895 2:63152566-63152588 AAGAGTAACCAGATGTTGGCAGG - Intronic
931996978 2:67848076-67848098 AAGATTAACTACCTCTTTGAAGG + Intergenic
932474822 2:71997272-71997294 AAGAGACACAAGTTCTTGGATGG - Intergenic
932779543 2:74551392-74551414 AAGAGTCACAAGGACTTTGATGG - Intronic
935365311 2:102283216-102283238 TAGAGGAAAAAGCACTTGGATGG + Intergenic
935972000 2:108538809-108538831 AAGATGAAAAAGTTCTTGGAAGG - Intronic
939589596 2:144047698-144047720 AAGAATAATAAACTCTTGAAGGG - Intronic
939608866 2:144285886-144285908 GAGAGTAACAAGCTACTAGAAGG - Intronic
939894546 2:147775837-147775859 AAAATTAAGAACCTCTTGGAAGG - Intergenic
940206225 2:151204831-151204853 GAGAGTGACAAGCTCTGTGAGGG - Intergenic
942503755 2:176619712-176619734 AATAGAAACCAGCTCCTGGAAGG - Intergenic
943348234 2:186766651-186766673 AAGACTAAGACTCTCTTGGATGG - Intergenic
943560029 2:189450316-189450338 AAGAGCAACAAGCTCTTGTGTGG + Intronic
945987591 2:216367880-216367902 AAGTGTAAAAATATCTTGGAAGG - Intronic
946000635 2:216479071-216479093 AAGGAAAACAAGCTTTTGGAAGG - Intronic
947500112 2:230665391-230665413 AAGTGCTACAAGCTCCTGGAGGG + Intergenic
948024011 2:234762266-234762288 AAGAAGAACAAGCTCTTACAAGG - Intergenic
1169570184 20:6897775-6897797 ACAAGTAACAACCTCTTGGTGGG + Intergenic
1169803903 20:9540026-9540048 AAGAGAAACAAGCTTCTGTAAGG + Intronic
1173382071 20:42554514-42554536 AAGAGTAACAGCCTCTTAGTGGG + Intronic
1178384223 21:32136433-32136455 AAGAAGAACAAGTTCTTGCAAGG + Intergenic
1179285800 21:39976471-39976493 AAGATAAAAAAGCTCTGGGAAGG - Intergenic
1181136887 22:20773641-20773663 CTGAGGAACGAGCTCTTGGAAGG + Intronic
1181621958 22:24097277-24097299 AATAGTAGCTAACTCTTGGAAGG - Intronic
1181925996 22:26359172-26359194 AGCAGGAACCAGCTCTTGGAAGG - Intronic
1182054877 22:27344656-27344678 AAGAGGAAGAAGCACTTGAAAGG - Intergenic
949444375 3:4117932-4117954 AATAGTCACAGGCTCTTGGTGGG - Intronic
955633339 3:60998994-60999016 AAGAGTAACCAGCTCTTGGCAGG + Intronic
956865679 3:73366588-73366610 AAGATGAACAAGCAATTGGATGG - Intergenic
957459911 3:80502699-80502721 AGGACTAAGAAGCTCATGGATGG - Intergenic
958574340 3:95928292-95928314 AAGAATAACATTCTCTAGGATGG + Intergenic
963575469 3:147056240-147056262 AAGAGTAATAAGCCCTATGATGG - Intergenic
964447628 3:156776732-156776754 AAGAGCACCAAGCACTTGGATGG - Intergenic
965630226 3:170725350-170725372 AAAAGTACTAAGCACTTGGAAGG - Intronic
967269532 3:187721284-187721306 TAGTGGAAAAAGCTCTTGGAGGG - Intronic
969122403 4:4919895-4919917 CAGAGTGGGAAGCTCTTGGAGGG + Intergenic
973195188 4:47431577-47431599 GAGAATAATAAGCTCCTGGAAGG + Intergenic
974499644 4:62683939-62683961 AAGATCACCAAGTTCTTGGAGGG + Intergenic
975867019 4:78734516-78734538 AAGGGCAACAACCTCTTTGAAGG - Intergenic
976618302 4:87100554-87100576 ATGGGTAACAAGCTTGTGGAGGG - Intronic
979119297 4:116874834-116874856 ATGAGTAACAAGCTCTATTAGGG + Intergenic
979597761 4:122553575-122553597 AGCAGTAACAAGTTCTTGCAGGG - Intergenic
979944120 4:126804555-126804577 AAAAGAAAAAAGCTTTTGGAAGG + Intergenic
986804585 5:11297655-11297677 CATAGTAAAAAGCTCTTTGAGGG + Intronic
987328289 5:16832451-16832473 AGGAGTCACAAGCTCTCAGAAGG + Intronic
989008128 5:36838285-36838307 AAGAGCCACAAGATCTTGGCAGG + Intergenic
994710187 5:103256902-103256924 AACACTAAAAAGCTCTGGGAAGG + Intergenic
998180121 5:139931358-139931380 GAGAGTAACAAGATCTCTGAGGG + Intronic
998489129 5:142530592-142530614 AATAGTAATATGATCTTGGATGG - Intergenic
1001730237 5:173948505-173948527 AAGATTAACATGCTCATGGTAGG + Intronic
1002514669 5:179748748-179748770 AAGATTTACAAGCTTCTGGATGG + Intronic
1008218029 6:48819368-48819390 AAGAGTAATAAGTTCTTGTTTGG - Intergenic
1009966761 6:70586389-70586411 AAGAATAACAAACTCTGGCAAGG - Intronic
1011006926 6:82655970-82655992 AAGAGTAACACACTCCTGAATGG - Intergenic
1011323175 6:86119610-86119632 AAGAGTCAGAAGCTCTTTGGTGG + Intergenic
1014107263 6:117581212-117581234 CAGAGTATCAAGGTCTGGGATGG + Intronic
1017540345 6:155396094-155396116 AAGAGTAACAAGATGATGGAAGG + Intronic
1018001961 6:159587392-159587414 AAAAGCAACAGCCTCTTGGAGGG - Intergenic
1020308798 7:6854503-6854525 AAGAGAAACAGGCTGGTGGAGGG - Intergenic
1026499193 7:70928585-70928607 AAGAGTAACAACCCTTTTGATGG + Intergenic
1031643977 7:124201019-124201041 AAGAGTAAATAGCCTTTGGATGG + Intergenic
1032374068 7:131392198-131392220 AAGAGGTACAGGGTCTTGGAAGG + Intronic
1033075608 7:138247411-138247433 AAAAATAACAAGCTATTGAATGG - Intergenic
1035215480 7:157363402-157363424 AAAAGTAAAAATCTCTTAGAAGG - Intronic
1036042483 8:5101402-5101424 AAGAGTAACACCCTCTTTCAGGG + Intergenic
1037234528 8:16702536-16702558 AAAAGAAACAAGCTTTTGGCCGG + Intergenic
1038585892 8:28789091-28789113 AAGAGCAAGATGCTTTTGGAGGG + Intronic
1040802446 8:51358342-51358364 AAGACGAAAAAGCTCTTAGAAGG - Intronic
1041700469 8:60783533-60783555 CAGAGTCACAAGCTTTTGGTAGG + Intronic
1045113767 8:98959481-98959503 AAGAGTCATAAGCTCTCAGAGGG + Intergenic
1046858764 8:119066773-119066795 AAGAGTAAGAAGGTCATGGAGGG + Intronic
1047107451 8:121748827-121748849 AAGAAAAACAAGCTGATGGAAGG - Intergenic
1047688605 8:127327749-127327771 AAGAGTAGCAAGCTCATGGCAGG - Intergenic
1047967150 8:130054616-130054638 CAGAGTAAGAAACTCATGGAAGG - Exonic
1048774597 8:137931972-137931994 TAGAGTAACAAGCCCCTGTAAGG + Intergenic
1051295034 9:15586636-15586658 CAGAGTAGCATGCTCTTGGAAGG - Intronic
1052728842 9:32262076-32262098 AAGAGTATTAAGCACTTTGAAGG - Intergenic
1053185946 9:36016477-36016499 AATAGTCACAAGTTCCTGGAGGG + Intergenic
1053560795 9:39191882-39191904 AAGTGGAACATGCTCTTTGATGG - Intronic
1053824897 9:42012132-42012154 AAGTGGAACATGCTCTTTGATGG - Intronic
1054136324 9:61427073-61427095 AAGTGGAACATGCTCTTTGATGG + Intergenic
1054605674 9:67175231-67175253 AAGTGGAACATGCTCTTTGATGG + Intergenic
1055799414 9:80017325-80017347 AAGATTAAAAATCTCTTTGAAGG - Intergenic
1057479777 9:95435670-95435692 AAGATTAAGAATCTCCTGGAAGG + Intergenic
1059618653 9:115978864-115978886 AAGAAGAACAAACACTTGGAAGG - Intergenic
1059958862 9:119545656-119545678 TAGAGTAAGCAGCTCTAGGATGG - Intergenic
1187006587 X:15238896-15238918 AGGAGTCAAAAGGTCTTGGAGGG + Intronic
1193084384 X:77436380-77436402 AAGACTGTCAGGCTCTTGGATGG + Intergenic
1193713446 X:84907224-84907246 AAAAGTTACAAGCTCTTTCAGGG - Intergenic
1195757820 X:108216651-108216673 AAGAGCTATACGCTCTTGGAGGG - Intronic
1198050749 X:132951226-132951248 AAGTATGAGAAGCTCTTGGATGG - Intronic
1198152997 X:133929526-133929548 AAGAGTAAAAATGTCTTGTATGG - Intronic
1202587047 Y:26442046-26442068 AAGAGAAACAAACTCTTAGTTGG + Intergenic