ID: 1098284569

View in Genome Browser
Species Human (GRCh38)
Location 12:68894445-68894467
Sequence TAGTGGGAAATTCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098284569_1098284578 6 Left 1098284569 12:68894445-68894467 CCCTCCACCCGAATTTCCCACTA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1098284578 12:68894474-68894496 AACACAAATGCGCCCACAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 83
1098284569_1098284577 3 Left 1098284569 12:68894445-68894467 CCCTCCACCCGAATTTCCCACTA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1098284577 12:68894471-68894493 GCTAACACAAATGCGCCCACAGG 0: 1
1: 0
2: 0
3: 11
4: 70
1098284569_1098284579 10 Left 1098284569 12:68894445-68894467 CCCTCCACCCGAATTTCCCACTA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1098284579 12:68894478-68894500 CAAATGCGCCCACAGGAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098284569 Original CRISPR TAGTGGGAAATTCGGGTGGA GGG (reversed) Intronic
900586725 1:3436234-3436256 AAGTGGGACATTCGGACGGATGG + Exonic
900631640 1:3639562-3639584 CAGTGGGAAATGCAGGTGGAGGG - Intronic
902403047 1:16168259-16168281 TATTGGGAAACTGGGGTGGGAGG - Intergenic
904092345 1:27954271-27954293 AAGTGGGACATTGAGGTGGAAGG + Intronic
906679053 1:47712617-47712639 TAGTGGGAAGTCTGGGGGGACGG - Intergenic
907074419 1:51565412-51565434 AAGAGGGAAACTGGGGTGGAGGG - Intergenic
909347850 1:74613653-74613675 TGGTGGGACTTTTGGGTGGATGG - Intronic
915839725 1:159204497-159204519 TGCTGGGAAATTGGAGTGGAAGG - Intronic
918255597 1:182743577-182743599 TAGTGGGAAATGATGCTGGAAGG - Intergenic
919556519 1:199061798-199061820 TAGTCAGAAATTAGGGTAGAGGG + Intergenic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
923364939 1:233249907-233249929 TTATGGGAAATTCAGGGGGAGGG - Intronic
1063233182 10:4086299-4086321 TGTTGGGAAACTCGGGTGAAAGG - Intergenic
1067411012 10:46064638-46064660 AAGTGGGAGAGTAGGGTGGAAGG - Intergenic
1070467919 10:76743269-76743291 AAGTGGGAAAGCTGGGTGGATGG + Intergenic
1074814118 10:117132024-117132046 CAGTGGGAAATTAAGGAGGAGGG + Intronic
1081051496 11:38347744-38347766 TAGTGGGAAATTCAGGGAAAAGG + Intergenic
1083393802 11:62374489-62374511 AAGTGTGAGATTTGGGTGGATGG + Intronic
1084022443 11:66425797-66425819 TAGGGGGCAATTTGGATGGACGG - Intronic
1086723064 11:90145722-90145744 TAGAGGGAGATTCAGGTAGATGG + Intronic
1092065017 12:5582889-5582911 TGGTGGGAAATGGAGGTGGAGGG - Intronic
1092288108 12:7141564-7141586 TAGTGGGAGATACGGGAGGGAGG - Intronic
1098284569 12:68894445-68894467 TAGTGGGAAATTCGGGTGGAGGG - Intronic
1102253979 12:111405797-111405819 GAGTCGGAGATTCGGCTGGAGGG - Intergenic
1102646329 12:114406226-114406248 TAGTGGAAATTTGGGGTGGGGGG - Intronic
1105643095 13:22286372-22286394 AAGTGGTAAATTGGGGTGGGGGG + Intergenic
1106416821 13:29552809-29552831 GAGTGGGAAATTGGGGCTGACGG - Intronic
1112696706 13:101957682-101957704 TTATGAGAAATTAGGGTGGATGG - Intronic
1113395930 13:109947496-109947518 TAGATGGAAATGTGGGTGGATGG + Intergenic
1121586727 14:95067924-95067946 TAGTGGGGAAATTGGGTGGGAGG - Intergenic
1129106155 15:73308671-73308693 TAGGGCCAAATTCGGGTGAAGGG - Intergenic
1131355067 15:91738108-91738130 TAGTGAATAATTGGGGTGGAGGG + Intergenic
1134521417 16:14920716-14920738 TCCTGGGAAGTTCGGGTGGGGGG + Intronic
1134958453 16:18392763-18392785 TCCTGGGAAGTTCGGGTGGGGGG - Intergenic
1135397479 16:22142191-22142213 CAGTGGGAGATTCAGGGGGAGGG + Intronic
1135814007 16:25615518-25615540 TATTGGGAATGTCAGGTGGATGG + Intergenic
1141835617 16:86537168-86537190 TTGTGGGAAATTTGGGAAGAAGG + Intronic
1143473336 17:7190014-7190036 GAGTGGGAAATGCGGGAGGGAGG - Exonic
1148560377 17:48602549-48602571 CAGTGGGAAATTGGGGATGATGG + Intronic
1148636925 17:49156149-49156171 CAGTGGGGAATTCAGTTGGATGG - Intronic
1151846717 17:76661313-76661335 TACTGGGGAATCCGGGTGAAGGG + Intergenic
1152386331 17:79977105-79977127 AAGTAGGATATTCTGGTGGACGG - Intronic
1155666655 18:28317348-28317370 TTGTGGGAGATTTGAGTGGAAGG + Intergenic
1157375511 18:47160530-47160552 TGGTGGGAAATTCAGGTGAGTGG - Intronic
1158388841 18:57026488-57026510 AGGTGGGAAATGGGGGTGGAAGG + Intronic
1158940542 18:62403037-62403059 GAGTGTGAAATTGGGGCGGAGGG + Intergenic
1160265925 18:77340879-77340901 CAGTGAGAAATTAGGGAGGAAGG + Intergenic
1162328903 19:10014947-10014969 TAGTGGGAAACATGGGTGCAAGG - Intronic
1163338284 19:16687869-16687891 TCGTGGGGAATTCTGGGGGATGG + Intronic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164913353 19:32029900-32029922 TAGTGGGAAATGCAGGTGGCAGG - Intergenic
1168407993 19:56120775-56120797 GAGTTGGAACTTCGGGGGGACGG + Intronic
925081889 2:1076295-1076317 TACTGGGCCATACGGGTGGAAGG - Intronic
928456724 2:31429046-31429068 TAGTGGGAAATGAGGCTGGAAGG - Intergenic
929846146 2:45530142-45530164 TAGTGGGAATTTCAGGTAAATGG + Intronic
931994608 2:67828028-67828050 AAGTGGGTGATTGGGGTGGAAGG - Intergenic
932878339 2:75475870-75475892 TAGTGAGAAATAAGGGTGCATGG + Intronic
935590295 2:104842135-104842157 TGATGGGAAATTTGGGGGGAGGG - Intergenic
936044948 2:109180210-109180232 TAGTGGGGAATACCAGTGGAGGG - Intronic
940142714 2:150511324-150511346 TTGGGGGAAATTAGGGTAGATGG + Intronic
943521010 2:188949387-188949409 AAGTGGGAAGGTGGGGTGGAGGG - Intergenic
1168767714 20:393190-393212 TAGTGGGAAACTCGGGAAGTGGG - Intronic
1174515611 20:51090168-51090190 CAGTGGGAAATTGGGGAGGTGGG - Intergenic
1176377068 21:6092027-6092049 CTGTGGGAAATCGGGGTGGAGGG + Intergenic
1179746407 21:43446217-43446239 CTGTGGGAAATCGGGGTGGAGGG - Intergenic
1180373988 22:12073730-12073752 AAGTGGGAAATCGGGGTGGGGGG - Intergenic
950904014 3:16521231-16521253 TGGTGGGTAGTTGGGGTGGATGG - Intergenic
960646772 3:119893727-119893749 TAGGGGGCAATCGGGGTGGATGG + Intronic
960867735 3:122219021-122219043 AGGTGGGAAATTAGGGTGGCCGG + Intronic
978195137 4:105962823-105962845 TTCTAGGAAATTCAGGTGGATGG + Intronic
984089878 4:175359826-175359848 AAGTGGGGAATTCAGGTAGAAGG + Intergenic
1202755573 4_GL000008v2_random:59169-59191 AAGTGGGAAATCGGGGTGGAGGG - Intergenic
999466468 5:151810818-151810840 TGTTGGGAAATTTGGGGGGATGG + Exonic
1001995978 5:176158756-176158778 TAGTGGCTCATTCAGGTGGAAGG + Intergenic
1002430467 5:179200565-179200587 TTGGGAGAAATTCAGGTGGAGGG + Intronic
1004700657 6:18076335-18076357 TAGTGGGAAGTTCAGATGAATGG + Intergenic
1006996136 6:38262969-38262991 TTGTGGGAAATTCCACTGGAAGG + Intronic
1007551421 6:42732792-42732814 TAGGGAGACATTCGAGTGGAAGG + Intergenic
1007912184 6:45527131-45527153 CAGTGGGAAAATCGAGTGCAAGG + Intronic
1009883407 6:69597006-69597028 GAATGGGAATTTGGGGTGGAGGG + Intergenic
1013251613 6:108340032-108340054 TAGTGGGAGGCTGGGGTGGAGGG - Intronic
1016317633 6:142808065-142808087 TAGTGGAAGATTAGGCTGGATGG - Intronic
1017017540 6:150113884-150113906 TAGTGGGGAGGACGGGTGGAAGG - Intergenic
1017171643 6:151461115-151461137 TAGTCTGAAATTCGGGGTGATGG + Intronic
1020224074 7:6266071-6266093 TAGTGGGAAATATGGAGGGAAGG - Intronic
1020749366 7:12121448-12121470 TAATGGGAAATTCTGGTGGCTGG - Intergenic
1023116328 7:36866247-36866269 TAGATGGAAATTCAGTTGGAAGG - Intronic
1023591526 7:41785410-41785432 CAGTGGCATATTGGGGTGGAAGG + Intergenic
1027189384 7:75988682-75988704 TGGGGGGAAAGCCGGGTGGAGGG + Intronic
1030261809 7:107573268-107573290 TAGTGGGATATTCCGCTGTACGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1038375043 8:27031897-27031919 TATTGGGAACATCTGGTGGAAGG + Intergenic
1039436808 8:37565055-37565077 CGGTGGGAAATGAGGGTGGATGG - Intergenic
1040770978 8:50974960-50974982 GAGTAGGAAATTGGGGAGGAAGG - Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1043527892 8:81115988-81116010 TAGTGGGCAATTTGGTTGGGAGG - Intergenic
1046716156 8:117569710-117569732 CAGTGGCAAATTGGGGTGGTGGG + Intergenic
1047961176 8:130013020-130013042 AAGAAGGAAATTCGGGTGGGAGG - Intronic
1048643544 8:136391585-136391607 TAGAGGGAAAATTGGGAGGAAGG + Intergenic
1048748753 8:137647093-137647115 TAGAGGGACATTTGGGTGGATGG - Intergenic
1049314934 8:141960462-141960484 TGTTGGGAAACACGGGTGGATGG - Intergenic
1060231088 9:121825990-121826012 CAGTGGGAAATTCTGGTGTGTGG + Intronic
1203536374 Un_KI270743v1:44005-44027 AAGTGGGAAATCGGGGTGGGGGG - Intergenic
1195885073 X:109629205-109629227 TCGTGGAAAATGGGGGTGGAGGG - Intronic
1199157277 X:144565301-144565323 TAGAGGGAAATCAGGGAGGAAGG - Intergenic
1200765973 Y:7080986-7081008 TAGTGGCCAATTCAGGTGGATGG + Intronic