ID: 1098288629

View in Genome Browser
Species Human (GRCh38)
Location 12:68933632-68933654
Sequence CGTCCCGCAGGAGCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098288629_1098288637 -2 Left 1098288629 12:68933632-68933654 CCCGCGCGGGCTCCTGCGGGACG 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1098288637 12:68933653-68933675 CGGGCGGCGTCGGCCCCGGCAGG 0: 1
1: 0
2: 4
3: 51
4: 310
1098288629_1098288638 -1 Left 1098288629 12:68933632-68933654 CCCGCGCGGGCTCCTGCGGGACG 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1098288638 12:68933654-68933676 GGGCGGCGTCGGCCCCGGCAGGG 0: 1
1: 0
2: 2
3: 36
4: 297
1098288629_1098288636 -6 Left 1098288629 12:68933632-68933654 CCCGCGCGGGCTCCTGCGGGACG 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1098288636 12:68933649-68933671 GGGACGGGCGGCGTCGGCCCCGG 0: 1
1: 1
2: 2
3: 30
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098288629 Original CRISPR CGTCCCGCAGGAGCCCGCGC GGG (reversed) Intronic