ID: 1098290719

View in Genome Browser
Species Human (GRCh38)
Location 12:68955054-68955076
Sequence GAGCCAGATGTGGAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 2, 1: 4, 2: 16, 3: 61, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098290719_1098290725 2 Left 1098290719 12:68955054-68955076 CCTTGCTGCTCCACATCTGGCTC 0: 2
1: 4
2: 16
3: 61
4: 390
Right 1098290725 12:68955079-68955101 GTTTGGCAGGTGTGGAATCCGGG 0: 1
1: 0
2: 9
3: 114
4: 333
1098290719_1098290724 1 Left 1098290719 12:68955054-68955076 CCTTGCTGCTCCACATCTGGCTC 0: 2
1: 4
2: 16
3: 61
4: 390
Right 1098290724 12:68955078-68955100 TGTTTGGCAGGTGTGGAATCCGG 0: 1
1: 0
2: 1
3: 45
4: 267
1098290719_1098290723 -6 Left 1098290719 12:68955054-68955076 CCTTGCTGCTCCACATCTGGCTC 0: 2
1: 4
2: 16
3: 61
4: 390
Right 1098290723 12:68955071-68955093 TGGCTCATGTTTGGCAGGTGTGG 0: 1
1: 1
2: 10
3: 78
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098290719 Original CRISPR GAGCCAGATGTGGAGCAGCA AGG (reversed) Intronic
900496472 1:2978244-2978266 GAGCCAGAAGTGGAGCCTGATGG - Intergenic
900679152 1:3906818-3906840 GAGGCAGACGTGGATCTGCAGGG - Intergenic
900828178 1:4943377-4943399 GACCCACATGTGCACCAGCAGGG + Intergenic
901740627 1:11339504-11339526 GAGTCAGACGTGCAGCTGCAGGG + Intergenic
904370214 1:30043484-30043506 AAGCCAGACGTGGAGCAGCAAGG - Intergenic
905214998 1:36400716-36400738 GTGCCAGGTGTGGAGCAGTGAGG + Intergenic
906132318 1:43468063-43468085 AAGCCAGGTGTGGAGCAGTAAGG + Intergenic
907153089 1:52306908-52306930 GAGCCAGGCATGGAGCAGCAAGG - Intronic
910203078 1:84720025-84720047 GATCCAAATGTGCAGCAGGATGG - Intergenic
910693751 1:89991024-89991046 GAGCCACACGTGGAGTAGGAAGG - Intergenic
911243836 1:95495359-95495381 GAGCCAGAAGTGGAGGAAAATGG - Intergenic
911275694 1:95854656-95854678 GAGTCAGATGTGGAGGAGCATGG - Intergenic
911949831 1:104158457-104158479 GAGACAGAGGTGGAGCAAAATGG + Intergenic
914939153 1:152006865-152006887 GAGGCAGATGAGGAGCAGCAGGG + Intergenic
915117207 1:153608526-153608548 GGGCCAGCTGTGGAGCAGGGTGG - Intronic
915163702 1:153936559-153936581 GCGCCAGATGGAGAGCGGCAAGG - Exonic
915565327 1:156709769-156709791 GAGGCAGATGTGGCCCAGTAGGG + Intergenic
915802500 1:158809078-158809100 GAGCAAGGTGTGCAGCAGCATGG + Intergenic
915882738 1:159689315-159689337 CAGGAAGATGTGGAGCAGGAAGG - Intergenic
916273863 1:162972423-162972445 AGGCCAGAGTTGGAGCAGCACGG + Intergenic
916966003 1:169944164-169944186 TAGCCAGGTGTGGAGCGGCGAGG + Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917162195 1:172070275-172070297 GAGCCAGATATGGAGCCCTAGGG + Intronic
917848696 1:179042220-179042242 AAGCCAGGTGCAGAGCAGCAAGG + Intronic
921097937 1:211902772-211902794 GAGCCAGGTGTGCAGTAGCGAGG - Intergenic
921138112 1:212280919-212280941 GAACCAGATGTTGGGAAGCAGGG + Intergenic
922776427 1:228216179-228216201 GAGACAGAGGTGGAACAGCCAGG - Intronic
924371949 1:243360476-243360498 GGGCTAGATGAGGAGAAGCAGGG - Intronic
1062788179 10:282715-282737 GTGCCTGGTGTGGAGCAGCCAGG - Intronic
1064010449 10:11731008-11731030 AATCCAGGTGTGAAGCAGCAAGG - Intergenic
1064115420 10:12573289-12573311 GTGTCAGATGTGGAGCGGGAAGG + Intronic
1065951431 10:30655180-30655202 AAGCCAGACTTGGAGCAGCCTGG + Intergenic
1066101421 10:32121807-32121829 GAGCCAGGTGCGGAACAGCAAGG + Intergenic
1067171537 10:43910881-43910903 GAGCCAGCTCTGGATCAGCAGGG + Intergenic
1067453203 10:46395057-46395079 GGGTCAGAGCTGGAGCAGCATGG + Intergenic
1067584032 10:47464709-47464731 GGGTCAGAGCTGGAGCAGCATGG - Intronic
1068213344 10:53951824-53951846 GAGCCAGGTGCAGAGCAGCAAGG + Intronic
1069121941 10:64577738-64577760 AAGCCAGGTGTGGAGCTGCAAGG - Intergenic
1070237118 10:74640181-74640203 GAGCTAGATCGGTAGCAGCAGGG + Intronic
1070401265 10:76055611-76055633 GAGCCAGGTGTGGAGTGGTAAGG + Intronic
1070956324 10:80465852-80465874 GATTCAGATGTGAAGAAGCAGGG - Intronic
1071053049 10:81474097-81474119 GAGCCAGATGCAGAGCAGTGAGG - Intergenic
1071358418 10:84821074-84821096 GAGCCACCTGTGGAGCTGGAAGG + Intergenic
1072192948 10:93090934-93090956 GGGCCAGATCTGGAGAATCAAGG - Intergenic
1072753448 10:98000524-98000546 GAGTCAGATGTGGAGTGGCAAGG - Intronic
1073733690 10:106321052-106321074 AAGCCAGATGCAGAGCAGCAAGG - Intergenic
1073930353 10:108567384-108567406 AAGTCAGGAGTGGAGCAGCAAGG - Intergenic
1074979448 10:118608124-118608146 AAGCCAGGTGCAGAGCAGCAAGG + Intergenic
1075730283 10:124631685-124631707 GAGCCTGAGTGGGAGCAGCAAGG - Intronic
1076992256 11:281547-281569 GAGCCAGAGGAGGAGGAGGAGGG + Exonic
1077109708 11:856700-856722 CAGCCAGATGGGGAGCAGCTAGG - Intronic
1077177068 11:1195808-1195830 GAGCCTGACGTGGAGCAGGCAGG + Intronic
1079472170 11:20789242-20789264 GAGTCAGGCATGGAGCAGCAAGG + Intronic
1079951654 11:26813167-26813189 AGGCAAGATGTGGAGAAGCATGG - Intergenic
1081408157 11:42722274-42722296 GAGGCAGATGTGAAGAAGGAAGG - Intergenic
1083489569 11:63005999-63006021 GAACCAGATGTGGAGCAAATGGG + Intronic
1084697260 11:70763060-70763082 GAGCCTGATCTGAAGGAGCAGGG + Intronic
1084806452 11:71582548-71582570 CAGCCTGAGGAGGAGCAGCAGGG + Exonic
1084887693 11:72221731-72221753 GAGCCAGAGTTGCAGCATCAGGG - Exonic
1085334096 11:75678161-75678183 GAGCCAGGCGTGGAACAGCAAGG + Intergenic
1085505560 11:77056693-77056715 GGGCCAGATGTGGTGGGGCAGGG + Intergenic
1085860408 11:80226513-80226535 GAACCAAATTTTGAGCAGCAAGG + Intergenic
1087210930 11:95446094-95446116 GAGCCAGGGGCAGAGCAGCAAGG + Intergenic
1087534284 11:99424441-99424463 GAGCCAGGTGTGGAGCGGCAAGG + Intronic
1088135788 11:106553549-106553571 AAGTCAGGCGTGGAGCAGCAAGG - Intergenic
1088568436 11:111197500-111197522 TGCCCAGATGTGGAGCAGAATGG + Intergenic
1088937515 11:114418063-114418085 GAGGCAGAAGAGAAGCAGCAAGG - Intronic
1089262294 11:117231744-117231766 GAGCCGGGTGTGGAACAGCGAGG - Intronic
1089452046 11:118605681-118605703 GCTCCAGATGTGGAGCAGGGCGG + Intergenic
1090124296 11:124069844-124069866 GAGCCAGAAGGGGAGCGGGAAGG + Intergenic
1091324953 11:134679098-134679120 GAGGAGCATGTGGAGCAGCAAGG - Intergenic
1091685104 12:2555945-2555967 GAGACAGTGGTGGAGCAACAAGG - Intronic
1091792654 12:3280640-3280662 GAGTCAGATGTGATACAGCAAGG + Intronic
1092283306 12:7113762-7113784 GAGCGAGGTGAAGAGCAGCAGGG + Intergenic
1093632771 12:21430133-21430155 TGCCCAGATGTGGGGCAGCAAGG - Intergenic
1094018196 12:25885709-25885731 AAGTCAGGTGTGGAGCGGCAAGG - Intergenic
1095382456 12:41612071-41612093 GAGCCACATCTTGAGCATCAGGG - Intergenic
1095949119 12:47772286-47772308 GAGACAGATCTGTAGCAGGAGGG - Intronic
1096185380 12:49577043-49577065 GAGGCACAAGTGGAGCTGCAGGG + Intronic
1097078458 12:56412356-56412378 GAACCAGATGTGCAGCAGCAAGG + Intergenic
1097194416 12:57235803-57235825 GTCCCAGCTGTGGAGCAGGAGGG + Exonic
1097446399 12:59678031-59678053 GAGCCAGGTGTGGAGCAGTGAGG + Intronic
1098290719 12:68955054-68955076 GAGCCAGATGTGGAGCAGCAAGG - Intronic
1099033862 12:77560874-77560896 GAGCCAGAAGTGCAGCAGTGAGG - Intergenic
1099683215 12:85855461-85855483 GAGCCAGGTGTGGAGTGGTAAGG + Intergenic
1099713890 12:86265173-86265195 GAGCCAGGCGTGGAGCAGTGAGG - Intronic
1100474268 12:94921368-94921390 CAGCCAGAAGTGAAGCAGCCAGG - Intronic
1100640436 12:96477253-96477275 GAGCCAGATAGTGAGCAGCAAGG + Intergenic
1100672695 12:96834427-96834449 AAGTCAGGTGTGGAGCAGCAAGG + Intronic
1101580769 12:106039403-106039425 GAGCCAGGCATGAAGCAGCAAGG + Intergenic
1103173817 12:118844482-118844504 GAACCAGATGTGGAACTGCGAGG - Intergenic
1104570974 12:129925821-129925843 GACCAAGATGTGGAGCAGCTGGG + Intergenic
1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG + Intergenic
1104743491 12:131195482-131195504 GTGCCATTTGTGCAGCAGCAGGG + Intergenic
1104763521 12:131312397-131312419 GAGACAGATGCGAAGCAGAAAGG - Intergenic
1104790842 12:131481202-131481224 GTGCCATTTGTGCAGCAGCAGGG - Intergenic
1105048672 12:133028361-133028383 GAGTCAGGTGTGGAGCAGCAAGG - Intergenic
1106379675 13:29224041-29224063 CAACCAGGTGTGGAGCAGCAAGG - Intronic
1106899261 13:34337768-34337790 GAGGAAGATGTGGAGAAGAAAGG + Intergenic
1107465652 13:40647548-40647570 TAGCCAGATGTGGTGGTGCACGG - Intronic
1107819437 13:44272909-44272931 CAGCCAGATATGAAACAGCAGGG + Intergenic
1108542296 13:51455654-51455676 AAGCCAGGTGCGGAGCAGCGAGG + Intergenic
1109008650 13:56910471-56910493 GAGCCAGGCGTGGAGCAGTGAGG - Intergenic
1109831642 13:67798928-67798950 TACCCAGATGTGGGGCAGAAGGG - Intergenic
1110439004 13:75507232-75507254 GAGCCAGGCGTGGAGCAGCAAGG + Intergenic
1110670122 13:78168456-78168478 GAGACAGGCATGGAGCAGCAAGG + Intergenic
1111202696 13:84961217-84961239 GAGCCAGGTGGGCAGCAGCAAGG + Intergenic
1111487678 13:88926137-88926159 GAGCCAGGGATGGAGCAGCAAGG + Intergenic
1112644825 13:101318246-101318268 GAGCCAGGTGGGGAGCAGTGCGG + Intronic
1112913969 13:104523082-104523104 GAGGCAGAGGAGGAGAAGCAGGG - Intergenic
1114533783 14:23410723-23410745 GAGCAAGATGTGGAGGCCCAGGG - Intergenic
1115562167 14:34592707-34592729 TAGCCAGACGTGGTGCCGCATGG - Intronic
1116151149 14:41144561-41144583 GAGCCAGGTGTGGAGCAGGGAGG + Intergenic
1116713294 14:48396990-48397012 GAGCTAGAGCTGGAGCAGCTGGG - Intergenic
1116837658 14:49786725-49786747 GAGCAAGATCTGGATCAACAGGG - Exonic
1116919940 14:50561197-50561219 GAACTAGGTCTGGAGCAGCAAGG - Intronic
1116961785 14:50974235-50974257 GAGTCAGGTGTGGAGTGGCAAGG - Intergenic
1117412973 14:55467686-55467708 GAGCCAGGTGTGGCGCAGCGAGG + Intergenic
1119036325 14:71232744-71232766 GAGTCAGGTGTGGAGCAGTGAGG - Intergenic
1119055184 14:71412224-71412246 GAGCCACATGTGGCACAGGATGG + Intronic
1119678097 14:76571344-76571366 GGGCCACATGTGGCCCAGCAAGG + Intergenic
1120405858 14:84092229-84092251 GAGCCAGGGGTGTAGCAGCTAGG - Intergenic
1120867102 14:89304721-89304743 GGGCCAGACGAGGAGCAGCCGGG - Intronic
1122243539 14:100384544-100384566 GTGTCAGAGGTGGGGCAGCATGG + Intronic
1122874372 14:104656741-104656763 GAGGCAGAGGTGGGGCAGCCAGG + Intergenic
1122945751 14:105008122-105008144 GGCCCAGATGTGGCCCAGCAGGG + Intronic
1123124678 14:105937895-105937917 CAGCTGGATGTGCAGCAGCAGGG - Intergenic
1124436428 15:29652806-29652828 GAGCCAGGCGTGGAGTGGCAAGG - Intergenic
1124515824 15:30366740-30366762 GAGACAGATGCGTAGCAACATGG - Intronic
1124727096 15:32163991-32164013 GAGACAGATGCGTAGCAACATGG + Intronic
1127525785 15:59791207-59791229 GAGTCAGGTGTGGAGTGGCAAGG + Intergenic
1127549744 15:60025190-60025212 GAACCAGATTTGGAACAGAAGGG - Intronic
1127931131 15:63598166-63598188 GAGCCAGAGGTGGAGAAGCCAGG + Intronic
1129325715 15:74799256-74799278 GAACCAACTGGGGAGCAGCAGGG - Exonic
1129591208 15:76916544-76916566 GAGCCAGGGGCGGAGCAGCAAGG - Intergenic
1129752685 15:78077143-78077165 GGGCGGGATGTGGAGAAGCAGGG + Intronic
1130431394 15:83850954-83850976 GAGCCACATTTTGAGCAGCACGG - Intronic
1130567048 15:85005258-85005280 TAGCCAGATGTGGTGGTGCATGG - Intronic
1130996850 15:88908867-88908889 GAGCCAGCTGGGTGGCAGCAGGG - Intronic
1131568195 15:93505677-93505699 GAGCCAGGTGCGGAGCAGCAAGG + Intergenic
1132747887 16:1444504-1444526 GAGGCAGGTGTGGGGCAGCGGGG + Intronic
1133091953 16:3411634-3411656 GAGCCAGGTATGGGGCAGCTCGG - Intronic
1133271002 16:4610785-4610807 GAGGCAGGTGGCGAGCAGCAGGG - Intronic
1133283175 16:4678540-4678562 GAGACAGATGTGGAGAGACAGGG + Intronic
1135986924 16:27190612-27190634 GAGCCAGGCATGGAGCAGCCAGG - Intergenic
1137331758 16:47504887-47504909 GCCCCAGAGGTGGAGCACCAGGG + Intronic
1137334190 16:47532495-47532517 GAGCCAGATGTGGAGTGGTGAGG + Intronic
1137816814 16:51405881-51405903 GAGCCACATGTGGCCCAGGATGG + Intergenic
1138067212 16:53954748-53954770 GAGCCGGAAGTGGTGCAGCAGGG + Intronic
1138633646 16:58319438-58319460 GAGCCAGATGTCTGGCAGCAAGG - Intronic
1138679557 16:58675111-58675133 GAGCCAGAAGAGGAGGAGCTGGG - Intronic
1138878416 16:60980169-60980191 GAGCCAGGCGTGGAGCAGCAAGG - Intergenic
1138998389 16:62479156-62479178 AAGCCAGGTGTGGAGTGGCAAGG - Intergenic
1141266474 16:82502296-82502318 AAGCCAGATATGGTTCAGCAAGG + Intergenic
1141818196 16:86427052-86427074 GAGGCCGAGGTGGAGCTGCAGGG + Intergenic
1142038821 16:87879656-87879678 GGTTCACATGTGGAGCAGCATGG - Intergenic
1143375134 17:6462874-6462896 GAGCACCATGTGGAGCACCATGG + Intronic
1145216931 17:21059939-21059961 GAGCCAGGTGAGGAGCGGCAAGG + Intergenic
1145789418 17:27616727-27616749 GATCCACATGTGTACCAGCACGG - Intronic
1146261604 17:31425795-31425817 GAGCCAGAGGGGGAGCCCCAGGG + Intronic
1146555918 17:33823920-33823942 AAGCCAGACGTGGAGAAGAATGG - Intronic
1147386879 17:40088226-40088248 AAGGCAGCTGTGGAGCGGCAGGG - Exonic
1147403282 17:40193553-40193575 GAGACAGATGTTGGGCAGGAAGG - Intronic
1148523941 17:48311494-48311516 GGGTAAGAGGTGGAGCAGCAAGG + Intronic
1149169618 17:53793185-53793207 GAGCCAGGTGGGGAGTGGCAAGG - Intergenic
1149256744 17:54836180-54836202 AAGCCAGGTGTGGAGCAGTGAGG + Intergenic
1149281776 17:55112804-55112826 GGGCCAGATGAGGAGCAGTCAGG + Intronic
1149593943 17:57852309-57852331 GAGCAAGCTGTCGGGCAGCAGGG + Intergenic
1150804909 17:68311050-68311072 TAGCCAGATGTGGCGGTGCACGG + Intronic
1151413700 17:73947836-73947858 GAGCCTGAGCTGGAGCAGCGAGG + Intergenic
1151544704 17:74785632-74785654 GGGCCAGGAGTGGAGCAGGAGGG + Intronic
1152132451 17:78485372-78485394 GAGACAGAGGAGGAGCAGCCGGG - Intronic
1153054720 18:934637-934659 GAGCCCCATGTGGAGCCACAGGG + Intergenic
1153230819 18:2933849-2933871 GTGGCAGCTGTGGAGCTGCAGGG + Intronic
1153977824 18:10284946-10284968 GGGACAGCTGGGGAGCAGCAAGG + Intergenic
1155522451 18:26682695-26682717 GAGCCAGTTGTTGAGAAGCTAGG - Intergenic
1155830750 18:30512987-30513009 AAGCCAGGTGTGCAGCAGTAAGG + Intergenic
1156244312 18:35283520-35283542 GAGCCAGGCGTGAAGTAGCAAGG + Intronic
1156462558 18:37329541-37329563 TGGCCAGATGTGGCACAGCACGG + Intronic
1157506796 18:48232017-48232039 GAGCCAGGTGTGGAGCAGCGAGG - Intronic
1158186490 18:54777529-54777551 GAGAGATGTGTGGAGCAGCATGG + Intronic
1159458668 18:68694501-68694523 GAGCGAGGCATGGAGCAGCAAGG - Intronic
1159461137 18:68723668-68723690 ATGCAAGATGTGGAGCAGCTTGG + Intronic
1159518967 18:69494976-69494998 GAGCCAGGTGTGGAGCAGCAAGG + Intronic
1159930833 18:74311664-74311686 GAGCCAGGTGTGGAGGGACAAGG + Intergenic
1160083451 18:75753030-75753052 GAGCCAGGTGTGGAGCAGCAAGG + Intergenic
1160629897 18:80239524-80239546 GGGCCACATGTGGAACAGGATGG - Intronic
1161579293 19:5071902-5071924 GAGCCAGCTCTTGAGCAGCTGGG - Intronic
1161579906 19:5075109-5075131 GGGTCAGATGTGGACCAGGAGGG - Intronic
1161781937 19:6298646-6298668 GTGCCAGGTGTGGAGTGGCAAGG - Intergenic
1161939669 19:7394786-7394808 GATCCAGAGGGAGAGCAGCAGGG - Intronic
1162132549 19:8536275-8536297 GTACCAGATGGGGAGCACCAAGG - Exonic
1164826736 19:31289660-31289682 GAGCCAGATGCCCTGCAGCACGG + Intronic
1164984555 19:32638841-32638863 GAGCCAGGTGTGGAGTGGCGAGG - Intronic
1165913750 19:39245395-39245417 GAGCCAGATGAGCAGCTGGAGGG + Intergenic
1165917211 19:39268229-39268251 GAGCCAGATGAGCAGCTGGAGGG - Intergenic
1166540146 19:43599696-43599718 GTTCCAGATGTGGAGCAACTTGG + Exonic
1166749968 19:45159915-45159937 GAGGCATCTGTGTAGCAGCAGGG - Intronic
1167903237 19:52637817-52637839 GAGAGACCTGTGGAGCAGCAGGG + Intronic
1168630034 19:57949430-57949452 GAGCCAGGCGCGGAGCCGCAAGG + Intergenic
925118823 2:1402032-1402054 GATCCAGATGAGGAGCAGCCAGG - Intronic
925132685 2:1504544-1504566 GAGGCAGATGTTGAGCACCCAGG - Intronic
925237643 2:2293447-2293469 GAGGCAGATCTGCAGGAGCAGGG + Intronic
925302425 2:2826713-2826735 AGGCCAGAGGCGGAGCAGCAGGG - Intergenic
927198374 2:20563526-20563548 GGGCCAGGTGTGGAGGGGCAGGG + Intronic
927687798 2:25184135-25184157 GTGCCAGAGATGGAGCAGCAGGG + Intergenic
928638009 2:33267240-33267262 AAGCCAGGTGTGGAGCAGTGAGG - Intronic
929014699 2:37482463-37482485 GAGCCAGGTGCAGAGCAGCAAGG - Intergenic
929061659 2:37930784-37930806 GAGCCAGATGTGCTGCCTCAGGG + Intronic
929144204 2:38692539-38692561 GAGTCAGATGAGGACCAGCATGG - Intronic
930006469 2:46901278-46901300 CAGCCAGCTGTGGAGAAGGAAGG + Intergenic
930957392 2:57218428-57218450 GAGCCAGACACAGAGCAGCAAGG - Intergenic
931091171 2:58888012-58888034 CAGCCAAAGGTGGAGAAGCATGG - Intergenic
931688536 2:64815562-64815584 CAGAAAGATTTGGAGCAGCATGG - Intergenic
932501517 2:72186992-72187014 GAGTCAGGTGTGGAGCAGCAAGG + Intronic
933042716 2:77488387-77488409 GAGTCAGGTGTGGAGTAGCAAGG - Intronic
934533043 2:95107835-95107857 GGGACACCTGTGGAGCAGCATGG - Intronic
935672926 2:105570923-105570945 GAGCCAGCAGTGCAGCTGCAAGG - Intergenic
935744143 2:106176163-106176185 CAGCCAGGTGGGGAGCAGCCAGG - Intronic
936093564 2:109515772-109515794 GAGGCAAAAGTGGAGCAGGAGGG + Intergenic
936370072 2:111896533-111896555 CAGGCAGATATGGAGGAGCAAGG + Intergenic
936460423 2:112710286-112710308 GTTTCAGATGTGGAGCAGCCTGG - Intergenic
937163910 2:119794394-119794416 GAGCCAGATGTGGAGCAGCAAGG + Intronic
938510443 2:131936731-131936753 GAGCCACATCTGAAGCAGCTGGG + Intergenic
938761003 2:134425938-134425960 AGGCCAGCTGTGGAGAAGCAAGG - Intronic
940362914 2:152814816-152814838 GAGCCAGATGTGCAGGAGACTGG - Intergenic
940956827 2:159738046-159738068 GAGCCAGACATGGATCGGCAGGG + Intronic
941020232 2:160400046-160400068 GAGCAAGATGGGGAGGAGCAGGG - Intronic
941043749 2:160649893-160649915 GAGCCAGGTGTGGAGAAGTGAGG - Intergenic
941138606 2:161747622-161747644 GAGACAGAGGTGGAGCAAGATGG - Intronic
941929040 2:170923179-170923201 GAGGCAGGTGTGGAGCAGTGAGG + Intergenic
942451796 2:176112734-176112756 CAGCCAGATGTGCAGCCGCTGGG - Intronic
943023365 2:182601170-182601192 GAGCCAGGCATGGAGCTGCAAGG + Intergenic
943965693 2:194328743-194328765 GAGCCAGGTGTGGAGCGGCAAGG - Intergenic
944303244 2:198149068-198149090 GAGTGAGATGTGGAGCAGGGAGG + Intronic
948048071 2:234958617-234958639 GAGCCAGTGGAGGAGCAGCTGGG + Intronic
948244098 2:236463790-236463812 GAACCAGATGTGGCTCAGCTGGG + Intronic
948604594 2:239126815-239126837 GAGCCAGCTCTGGGGCACCAGGG - Intronic
948656889 2:239481850-239481872 GAGCCAGCTGTGGATCCTCAGGG - Intergenic
948713307 2:239839459-239839481 GAGCCAGGCATGGAGCAGCAAGG - Intergenic
948857458 2:240736657-240736679 GGGCTAGAGGTGGAGCAGCTGGG - Intronic
949060872 2:241956635-241956657 GGGGCAGATGTGGAGAAGGAAGG + Intergenic
1168891302 20:1296785-1296807 GAGACAGAGGTGGAGAAGAATGG - Intronic
1168957150 20:1842087-1842109 GAGCCAGATGTGGAATTGCTGGG - Intergenic
1170110197 20:12796635-12796657 TAGCCAGATGTGGTGGTGCATGG - Intergenic
1170695069 20:18650537-18650559 AAATCAGAAGTGGAGCAGCATGG - Intronic
1171179257 20:23080558-23080580 TAGCCAGTGGTGGAGGAGCAAGG - Exonic
1172486563 20:35301868-35301890 GAACCACGTGGGGAGCAGCACGG + Intergenic
1173729608 20:45319108-45319130 GAGCTAGAGGTGGTGCTGCAAGG - Intergenic
1175001230 20:55632691-55632713 GAGACAGGTGTGGAGTGGCAAGG + Intergenic
1175395804 20:58660672-58660694 GACCCAGATGCAGAGCAGCATGG + Intronic
1175923826 20:62462432-62462454 GAGGCAGATGTGCAGGAGCTGGG + Intergenic
1176101738 20:63367614-63367636 AGGCCAGATGTGGTGCAGCCAGG + Intronic
1177713577 21:24811250-24811272 GTTCCAGAAGTGGAGCAGAAGGG - Intergenic
1177761025 21:25402307-25402329 AAGCCACAGGTGGAGCAGCTGGG - Intergenic
1177842107 21:26246105-26246127 TAGCCAGATGTGGAACAGCCTGG - Intergenic
1179407488 21:41137570-41137592 CAGCCAGGTGTGGAGCAGCAAGG - Intergenic
1179542595 21:42093361-42093383 GAGCCAGCTGTGGTGGCGCATGG - Intronic
1180025987 21:45162396-45162418 GAGCCAGGTGTGGAGTGGCAAGG - Intronic
1180840669 22:18957490-18957512 GAGCCAGATTGAAAGCAGCAGGG - Intergenic
1180935561 22:19622886-19622908 GGGTCAGATGGGGAGGAGCATGG - Intergenic
1180975151 22:19844097-19844119 GAGCCAGGTGGGGCCCAGCACGG + Intronic
1181003903 22:20000480-20000502 GAGCCAGATGGGAGGCTGCAGGG - Intronic
1182012167 22:27010177-27010199 AAGGCAGGTGTGGAGCAGCAAGG - Intergenic
1182243049 22:28932563-28932585 GATCAAGATGAGCAGCAGCATGG - Intronic
1182940316 22:34270371-34270393 CAGCCACATGTGGAGCAGCTGGG + Intergenic
1183261543 22:36798800-36798822 GAGCCAGAGGTGGAGCACGCGGG - Intergenic
1183288228 22:36981412-36981434 GAGGCAGATTTGGTTCAGCAGGG - Intergenic
1183535987 22:38401721-38401743 GGGCCTGGTGGGGAGCAGCAGGG + Intergenic
1183733082 22:39629197-39629219 GAGCGTCATGTGGAGCACCAGGG - Intronic
1184615539 22:45635697-45635719 CAGTCAGATGAAGAGCAGCAAGG + Intergenic
1184836855 22:47029116-47029138 CAGCCAAATGTGGAGAATCATGG + Intronic
1184869298 22:47225168-47225190 GAGTCAGGTATGGAGCAGCAAGG + Intergenic
1185132674 22:49048557-49048579 GAGCGAGAAGTTCAGCAGCAAGG + Intergenic
1185255337 22:49828167-49828189 GAGGCAGGTGGGGAGCAGCCGGG + Intergenic
949226490 3:1700865-1700887 GAGCCAGGCATGGAGCAGCGAGG - Intergenic
949721845 3:6998789-6998811 TAGCCAGAGGTAGAGCAGCTGGG + Intronic
950604643 3:14067453-14067475 CAGCCAGAAGTGGAGCAGCTAGG - Intronic
950694153 3:14684490-14684512 GAGGTGGATGTGGAGCAACAGGG + Intronic
951203212 3:19897437-19897459 CCGCCACATCTGGAGCAGCATGG - Intronic
951408566 3:22332191-22332213 GAGGCAGGTGTGGAGGAGCTGGG - Intronic
951562302 3:23981303-23981325 GAGTCAGGCATGGAGCAGCAAGG + Intergenic
952793472 3:37218419-37218441 AAGCCAGGCATGGAGCAGCAAGG - Intergenic
953012084 3:39036288-39036310 TAGCCAGATGTGGTGGGGCATGG - Intergenic
953032334 3:39186915-39186937 CGGCCAGATGTGGACCAGCAGGG - Exonic
953668037 3:44940111-44940133 GTGCCAGAGGTGAAACAGCAGGG - Intronic
953738465 3:45516183-45516205 GAGGAAGTTGTGGAGCAGTATGG + Exonic
953766686 3:45748222-45748244 AAGTCAGGTATGGAGCAGCAAGG - Intergenic
955009713 3:55002274-55002296 GAGCCAGGTGAGAGGCAGCATGG - Intronic
956858972 3:73303757-73303779 GCTCCAGAGGTGGATCAGCAGGG - Intergenic
956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG + Intergenic
957418025 3:79930373-79930395 GAGCCAGGCGTGGAGCAGTGAGG - Intergenic
958161100 3:89817918-89817940 AAGCCAGGTGTGGAGTGGCAAGG + Intergenic
958977541 3:100683595-100683617 GAGCCAGGTGTGGAGCGGTGAGG - Intronic
959756181 3:109902422-109902444 GAGCCAAATGTGGGTGAGCATGG + Intergenic
959897223 3:111618141-111618163 GAGCCAGGTGCAGAGCAGCAAGG - Intronic
960003647 3:112759795-112759817 AAGCTAGCTGTGGAACAGCAAGG + Intronic
961160699 3:124722286-124722308 GATCCAGATGTGGGGTTGCATGG + Intronic
961882225 3:130070023-130070045 GATCCTGATGAGGACCAGCAAGG + Intergenic
963040170 3:141064671-141064693 GAGCCAGATGAGGAGATGGATGG - Intronic
963454139 3:145522331-145522353 GAGACAGGCATGGAGCAGCAAGG + Intergenic
963805289 3:149715518-149715540 GAGTCAGGTGTGGAGCGGCAAGG - Intronic
965175376 3:165323478-165323500 GAGAAAGATGTGGAGCAAGATGG - Intergenic
965363038 3:167764582-167764604 GAGCCAGAAGTGGAATAACATGG - Intronic
966243252 3:177777899-177777921 TAGGGAGATGTGGAGCACCAGGG + Intergenic
967106970 3:186261864-186261886 GAGGCAGATGAGAAGCAGGAGGG + Intronic
967247668 3:187504239-187504261 GGGCCACATTTTGAGCAGCAAGG + Intergenic
967287640 3:187889002-187889024 GAGCAAGATCAGGGGCAGCATGG - Intergenic
968164427 3:196452941-196452963 GAGGCAGGTGTGGAGCAGCGAGG + Intergenic
968838204 4:2980908-2980930 AAGCCAGGTGCAGAGCAGCAAGG + Intronic
968890734 4:3367184-3367206 GAGGCAGCTGTGGTGCAGCGGGG - Intronic
969281295 4:6172440-6172462 AGGCCAGAGCTGGAGCAGCATGG - Intronic
969500124 4:7547552-7547574 GGGCCAGATGTGTCGGAGCATGG - Intronic
969508848 4:7605700-7605722 GAGGCAGATGTGAAACAGCAAGG - Intronic
970254488 4:14153622-14153644 GAGCCACATTTTGAGGAGCAAGG + Intergenic
971092539 4:23361655-23361677 AAGCCAGGCATGGAGCAGCAAGG - Intergenic
972158699 4:36197650-36197672 AAGCCAGGTGTGGAGCAGTGAGG + Intronic
972930907 4:44070951-44070973 GAGTCAGGCGTGGAGCAGCTAGG + Intergenic
973718452 4:53700548-53700570 CAGCCACATCTGGAGCAGCTGGG + Intronic
974023564 4:56712298-56712320 GAGCCAGGTGCAGAGCACCAAGG - Intergenic
974487548 4:62524823-62524845 CAGCCACAACTGGAGCAGCAAGG - Intergenic
974629015 4:64458645-64458667 AAGCTAGGTGTGGGGCAGCAAGG - Intergenic
974686695 4:65241329-65241351 GAGCCTGGTGAGGAGTAGCAAGG + Intergenic
974761694 4:66285090-66285112 AAGCCAGGTGCAGAGCAGCAAGG + Intergenic
976985886 4:91297429-91297451 GAGACAGATGTGGATAAGGAGGG + Intronic
977352571 4:95907086-95907108 GAGACAGATGCCCAGCAGCATGG - Intergenic
978229777 4:106385025-106385047 GAGTCAGGTGTGGAGTGGCAAGG + Intergenic
978824465 4:113004471-113004493 GAGCAAGATGTGGAGGTGGAAGG - Intronic
978880654 4:113698651-113698673 GAGCCAGGGGTGGAGAAGAAGGG - Intronic
979010912 4:115366641-115366663 GAGCCAGGTGTGCAGCAGTGTGG - Intergenic
979090448 4:116477187-116477209 AAGCCAGGCGTGGAGCAACAAGG + Intergenic
979728948 4:123998519-123998541 GAGCCTGATGAGGAGTAGCTGGG + Intergenic
980044690 4:127974515-127974537 TAGCCAGATGTGGTGGTGCATGG - Intronic
981482477 4:145253189-145253211 GAGCGGGATTAGGAGCAGCATGG + Intergenic
981483398 4:145260159-145260181 GAGCTGGAGCTGGAGCAGCAGGG + Intergenic
983784687 4:171716254-171716276 GAGTCAGGTGTGGAGCAGAGAGG - Intergenic
984102011 4:175498646-175498668 GAGTCAGGTGTGGAGCAGTGAGG + Intergenic
984834033 4:184002525-184002547 GAGCCAGGTGGGGCCCAGCAGGG + Intronic
985384045 4:189426320-189426342 GTGCCAGAGCTGGAGAAGCACGG + Intergenic
985916374 5:2921850-2921872 GAGCCAGGCATGGAGCAGCAAGG - Intergenic
986590396 5:9362911-9362933 GAGCCAGGTGTGGTGCTGAATGG - Intronic
987414395 5:17647846-17647868 GACCCAGATTTTGATCAGCAAGG - Intergenic
987794343 5:22607758-22607780 GAGCCATAGCTGGAGCAGCTAGG - Intronic
987815869 5:22900956-22900978 AAGCCAGGAGTGGAGCAGCGAGG + Intergenic
987875525 5:23675643-23675665 GAGCCAAGTGTGGAGCGGGAAGG - Intergenic
991361544 5:65826173-65826195 GAGGCAGATGTGGAACATAAAGG + Exonic
991367611 5:65885556-65885578 GAGTGAAATGTGAAGCAGCAAGG - Intergenic
991544861 5:67770584-67770606 GAGTGAGAGGTGGAGAAGCAAGG + Intergenic
992126335 5:73646060-73646082 GAGCCATTTCTGGTGCAGCAGGG - Intronic
993844793 5:92927694-92927716 GAGGCAAATGTGTAACAGCATGG - Intergenic
995146138 5:108788339-108788361 GAGCCAGGAGTGGAGCAGCAAGG - Intronic
995386752 5:111596935-111596957 GAGCCAGGTGTGGAGCAGCAAGG - Intergenic
995394441 5:111672654-111672676 GAGACATCTGTGGAGCAGCTGGG - Intronic
995724130 5:115166981-115167003 AAGCCAGGTGCAGAGCAGCAAGG - Intronic
995927120 5:117387175-117387197 AAGCCAGATGTGGAGTAGCAAGG - Intergenic
996574579 5:124967210-124967232 GAGCGAGATTTGGGGCAGCGTGG + Intergenic
998016399 5:138735559-138735581 GAGCCAGCTGAGGAGGAGCTGGG - Intronic
998019262 5:138755790-138755812 GAACCAGATGTGGAGATCCAGGG + Intronic
998334034 5:141355232-141355254 AAGGCAGATCTGGAGCAGCCGGG - Exonic
998792369 5:145778716-145778738 GAGTCAGGCGTGGAGCAGCGAGG - Intronic
1001487927 5:172133043-172133065 GAAGCAGAGGTGGGGCAGCAGGG + Intronic
1001717143 5:173825493-173825515 GAGACAGCTGTGGACCAGCCTGG + Intergenic
1002131891 5:177087012-177087034 GAGCCAGGTGAGGAGGAGCCAGG + Exonic
1002189591 5:177471816-177471838 GAGCAGGATGTGGGGCAACAGGG + Intronic
1004759112 6:18646490-18646512 GAGCCAGTCATGCAGCAGCAAGG + Intergenic
1005521613 6:26606179-26606201 GAGCAAGATCTGGATCAGAATGG - Intergenic
1006463697 6:34178491-34178513 GAGCCAGGTGCGGAGTGGCAAGG + Intergenic
1006612289 6:35301375-35301397 CACCCAGATGGGGAGCAGTACGG - Intronic
1007289960 6:40778163-40778185 GAGCAAGATTTTGAGTAGCAGGG - Intergenic
1007323402 6:41042907-41042929 GAGACAGACGAGGAGCCGCAGGG + Intronic
1007501389 6:42300436-42300458 GAGGCTGATATGGAGCAGAAAGG - Intronic
1010939120 6:81895200-81895222 GAGCCAGAAGTCAAGCAGAAGGG + Intergenic
1013292067 6:108728304-108728326 GAGCCTGAGCTGGAGAAGCAGGG - Intergenic
1015952045 6:138563087-138563109 GAAACAGATGTGGGGAAGCAGGG - Intronic
1016090291 6:139969744-139969766 TAACAAGAAGTGGAGCAGCAGGG - Intergenic
1016830075 6:148425164-148425186 GAGGCAGCTCTGGACCAGCACGG + Intronic
1017887098 6:158608351-158608373 GAGCCAGCTGTTGACCAGGAAGG - Exonic
1018177409 6:161189260-161189282 GAGCCAGATGGGGAGGAGGCAGG - Intronic
1018721855 6:166579026-166579048 AAGTCTGATGTCGAGCAGCATGG + Intronic
1018811986 6:167305034-167305056 GGGCCAGAGCTGGACCAGCAAGG + Intronic
1018988987 6:168659307-168659329 GGGCCACATGTGAAGCACCAGGG + Intronic
1019200252 6:170307927-170307949 GGACCATATCTGGAGCAGCAGGG + Intronic
1019610954 7:1936442-1936464 CAGGCAGCTGTGGAGAAGCAAGG - Intronic
1019731933 7:2633370-2633392 GAGGCGGAAGTGGAGGAGCAGGG + Intronic
1019879462 7:3845527-3845549 GAGCAAGATGTGGAGTGGCCAGG + Intronic
1020191718 7:6005048-6005070 TAGCCAGATGTGGTGGTGCATGG - Intronic
1021276760 7:18661483-18661505 GAGCAAAATGTGGAGTAGAATGG + Intronic
1021915105 7:25423609-25423631 GAGCAAGAAGAGCAGCAGCAAGG - Intergenic
1022909170 7:34883321-34883343 CAGCCACATCTGGAGCAGCTGGG + Intergenic
1023130000 7:36993198-36993220 GAGCCAGATATGGAACCACAGGG + Intronic
1023213049 7:37829251-37829273 GAGGCAGATCTGGAGGAGCCTGG - Intronic
1023624873 7:42106066-42106088 GAGGCAGGGGTGGAGCAGCCGGG + Intronic
1023848905 7:44139746-44139768 CAGCCAGATGAGGAGCACCGTGG - Intronic
1024359988 7:48458330-48458352 GTCCCACATTTGGAGCAGCAAGG - Intronic
1024974904 7:55104383-55104405 GATGCAGATGTGGAGCCCCATGG + Intronic
1024985073 7:55187521-55187543 TAGACAGAAGTGGTGCAGCACGG - Intronic
1025267335 7:57474520-57474542 CAGCTGGATGTGGAGCAGCTGGG - Intergenic
1025862095 7:65339749-65339771 GAGACAGAGGTGGAGCAAGATGG - Intergenic
1026216469 7:68353775-68353797 GGGCCACATGAGGAGCAGCAGGG + Intergenic
1027734786 7:81919679-81919701 AAGCCAGGTGTGGAGCAGTAGGG + Intergenic
1027911937 7:84261711-84261733 GAGCCAGGCGGAGAGCAGCAAGG - Intronic
1027995870 7:85424478-85424500 GAGCCAGGTGTGGAGTGGCAAGG - Intergenic
1028035013 7:85971692-85971714 AAGCCAGGTGTGGAGCAGCGAGG + Intergenic
1028091498 7:86708396-86708418 AAGGCAGATGAGAAGCAGCAGGG + Intronic
1030503317 7:110387141-110387163 CAGCAAGAGGTGGAGCAGCCTGG - Intergenic
1030711689 7:112757511-112757533 GAGGCAGCTGTGGATCTGCATGG + Intergenic
1031921837 7:127608218-127608240 GAGCCAGGAGTGGAGCAGTGAGG + Intergenic
1032653749 7:133905951-133905973 GAGCAAGCAGTGGAGCAGCATGG + Intronic
1034481384 7:151322411-151322433 AAGTCAGGTGTGGAGCGGCAAGG - Intergenic
1035418252 7:158706957-158706979 GAGCCAGGTGCAGAGCGGCAAGG + Intergenic
1036915332 8:12799057-12799079 GAGCCAGGTGTGGAGTGGCAAGG + Intergenic
1037143523 8:15546238-15546260 GGGCCAGATGTGGCGAAGGAAGG - Intronic
1037159522 8:15751219-15751241 GAGAGAGATATGGAGAAGCAAGG + Intronic
1042196700 8:66237421-66237443 AAGCCAGGTGCGGAGTAGCAAGG + Intergenic
1042531251 8:69818325-69818347 GGGCCACATTTTGAGCAGCAAGG - Intronic
1042609135 8:70578017-70578039 GAGCCAGACGTGGAGCAGCAGGG - Intronic
1043195675 8:77288507-77288529 AAGCCAGGTGTGGAGCAGTGAGG - Intergenic
1043756048 8:84005446-84005468 AAACCAGGTGTGGAGCTGCAGGG + Intergenic
1044367788 8:91369907-91369929 GAGGCAGATGAGGAGGAGAAGGG - Intronic
1044376064 8:91472586-91472608 GAGGCAGAGGTGGAGAAGGAAGG + Intergenic
1045300601 8:100907401-100907423 AAGCCAGGTGCTGAGCAGCAAGG + Intergenic
1045362887 8:101449300-101449322 GAGGGAGATGTTGAGCTGCAGGG + Intergenic
1046009166 8:108525515-108525537 GAGCCACATGTGGATCAGGAAGG - Intergenic
1046400955 8:113702908-113702930 CAGCCAGAGCTGGAGCAGCTGGG + Intergenic
1047795461 8:128250568-128250590 CAGCCTGATGTGGAGTAACAGGG + Intergenic
1048288463 8:133161522-133161544 GATGCAGGTCTGGAGCAGCAGGG + Intergenic
1048338981 8:133524586-133524608 AAGCCAGGCGTGAAGCAGCAAGG + Intronic
1049230044 8:141477239-141477261 GACCCAGCTGTGGGACAGCAGGG - Intergenic
1049664898 8:143838645-143838667 GAGCCAGCTGGGGAGGGGCAGGG + Intronic
1050009725 9:1173137-1173159 AAGGCAGATGAGGGGCAGCAGGG - Intergenic
1050809045 9:9719985-9720007 GAGCCAGGTGTGGAGTGGCAAGG - Intronic
1050926772 9:11273552-11273574 GAGCCAGCTGTGTAGCAGACTGG - Intergenic
1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG + Intronic
1052137110 9:24926349-24926371 GATACAGCTGTGAAGCAGCATGG + Intergenic
1052777466 9:32746977-32746999 AAGGGATATGTGGAGCAGCAGGG + Intergenic
1053895458 9:42737428-42737450 GAGCCAGGCACGGAGCAGCAAGG - Intergenic
1055816655 9:80213848-80213870 AAGCCAGGTGTGGAGCGGCGAGG - Intergenic
1055856192 9:80691412-80691434 GAGCCAGAGTTGGAGCTGCCAGG - Intergenic
1056559779 9:87719974-87719996 AAGCCAGATGTGGAGCAGACAGG - Intergenic
1058401524 9:104625155-104625177 TAGCCACATCTGGAGCAGCTGGG - Intergenic
1058545637 9:106058592-106058614 GAGCCAGGTGTGGAGTGGCAAGG + Intergenic
1058661917 9:107274305-107274327 TAGCAAGATGGGGAGCAGAAAGG + Intergenic
1059389446 9:113989627-113989649 GAGCCAGAGCTGGACCAGGAAGG - Intronic
1060414729 9:123422114-123422136 GAGCCAGATGTGAACCCTCAAGG - Intronic
1060759741 9:126237141-126237163 GATCCAGATGTGTTGCAGCAGGG + Intergenic
1060925861 9:127454684-127454706 GAGGCAGATGGGAAGGAGCACGG - Intronic
1061267467 9:129515134-129515156 GAGCCAGGTGTGGAGTGGCCAGG - Intergenic
1061944958 9:133903428-133903450 GAGCCTGATGTGGGGCTCCAGGG - Intronic
1062018545 9:134304621-134304643 GAGTCAGAAGTGAAGCAGCAGGG - Intergenic
1062158598 9:135067517-135067539 GAGACACATGCGGAGGAGCAGGG + Intergenic
1062285890 9:135772333-135772355 GGGCCAGGTGGGGAGCAGCTGGG - Intronic
1062674364 9:137731765-137731787 AAGCCAGGAGTGGAGCAGCGAGG + Intronic
1185954213 X:4471359-4471381 TAGCCAGATGTGGTGATGCAAGG + Intergenic
1186493305 X:9992314-9992336 GAGCGAGCTTTGGAGCAGCCTGG + Intergenic
1186547377 X:10464655-10464677 GAGACAGATGTGCAGCAGTCGGG + Intronic
1186805974 X:13140270-13140292 GAGCCAGGTGGGGAGTGGCAGGG - Intergenic
1187576034 X:20556513-20556535 CATCCAGATGTGCAGCACCAGGG + Intergenic
1188495988 X:30783455-30783477 GAGCCAGATGTGCAGGAGATGGG - Intergenic
1188852910 X:35153564-35153586 GAGACAGATTTGGAGGAACAAGG + Intergenic
1190703612 X:53006673-53006695 GATCTAGAGCTGGAGCAGCAGGG + Intergenic
1192267329 X:69547727-69547749 GAGCCAGGTGTGGAGTGGCAAGG - Intergenic
1192463283 X:71336280-71336302 GAGCCAGCTGTGGAGGAGACCGG + Intergenic
1192563563 X:72143901-72143923 GAGCCAGGGATGGAGCAGCCGGG - Intergenic
1193826911 X:86237662-86237684 AAGCCAGCTGTGGAGCGGCAAGG + Intronic
1194359209 X:92927885-92927907 GAGAAAGATGAGGAGCAGAAGGG + Intergenic
1195579595 X:106485925-106485947 GAGCCTCATCTGCAGCAGCAAGG - Intergenic
1196406459 X:115367572-115367594 GTGCCAGATCTGGGGAAGCAGGG - Intergenic
1198672595 X:139097384-139097406 GAGCCACATGTGGCCCAGGATGG - Intronic
1198857482 X:141033367-141033389 CAGCCACAGGTGGAGCAGCTGGG - Intergenic
1198905214 X:141554004-141554026 CAGCCACAGGTGGAGCAGCTGGG + Intergenic
1200667420 Y:6043920-6043942 GAGAAAGATGAGGAGCAGAAGGG + Intergenic
1201368358 Y:13234152-13234174 CAGCCAGATGTGGAGCGGCAAGG + Intergenic
1201667906 Y:16479689-16479711 GAGCCAGATTTTCAGAAGCAAGG + Intergenic