ID: 1098301300

View in Genome Browser
Species Human (GRCh38)
Location 12:69056618-69056640
Sequence GGACTGTGAGGTCCACCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098301291_1098301300 28 Left 1098301291 12:69056567-69056589 CCTCTGAGAGCCAGATTGTTCTT No data
Right 1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG No data
1098301297_1098301300 -6 Left 1098301297 12:69056601-69056623 CCTGTGATTGAGCCACTGGACTG No data
Right 1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG No data
1098301294_1098301300 2 Left 1098301294 12:69056593-69056615 CCGAATGCCCTGTGATTGAGCCA No data
Right 1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG No data
1098301293_1098301300 5 Left 1098301293 12:69056590-69056612 CCTCCGAATGCCCTGTGATTGAG No data
Right 1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG No data
1098301296_1098301300 -5 Left 1098301296 12:69056600-69056622 CCCTGTGATTGAGCCACTGGACT No data
Right 1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG No data
1098301292_1098301300 18 Left 1098301292 12:69056577-69056599 CCAGATTGTTCTTCCTCCGAATG No data
Right 1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098301300 Original CRISPR GGACTGTGAGGTCCACCAGT AGG Intergenic
No off target data available for this crispr