ID: 1098302385

View in Genome Browser
Species Human (GRCh38)
Location 12:69067405-69067427
Sequence GTGAGTGTAAAATGCAAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098302382_1098302385 13 Left 1098302382 12:69067369-69067391 CCTACTTCGAGGGTTGGCAGGAG No data
Right 1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098302385 Original CRISPR GTGAGTGTAAAATGCAAGGA CGG Intergenic
No off target data available for this crispr