ID: 1098303141

View in Genome Browser
Species Human (GRCh38)
Location 12:69074877-69074899
Sequence TATCCCTTTAATAAAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098303141_1098303143 29 Left 1098303141 12:69074877-69074899 CCTGAAATTTTATTAAAGGGATA No data
Right 1098303143 12:69074929-69074951 TCATGTGAACTATAGAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098303141 Original CRISPR TATCCCTTTAATAAAATTTC AGG (reversed) Intergenic
No off target data available for this crispr