ID: 1098303392

View in Genome Browser
Species Human (GRCh38)
Location 12:69077572-69077594
Sequence GTGGTGACCGGGGCTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098303384_1098303392 23 Left 1098303384 12:69077526-69077548 CCTGGAATCTAAAAAAGTTGCAC No data
Right 1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098303392 Original CRISPR GTGGTGACCGGGGCTGGGGA TGG Intergenic
No off target data available for this crispr