ID: 1098304693

View in Genome Browser
Species Human (GRCh38)
Location 12:69090788-69090810
Sequence CTGTTTGCAGAGAACAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098304690_1098304693 -1 Left 1098304690 12:69090766-69090788 CCTCTTGCCTTTTAAAAACATGC No data
Right 1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG No data
1098304688_1098304693 30 Left 1098304688 12:69090735-69090757 CCACTTCTCTTCTTTTATTCCTT No data
Right 1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG No data
1098304691_1098304693 -8 Left 1098304691 12:69090773-69090795 CCTTTTAAAAACATGCTGTTTGC No data
Right 1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG No data
1098304689_1098304693 11 Left 1098304689 12:69090754-69090776 CCTTTGCTTCAGCCTCTTGCCTT No data
Right 1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098304693 Original CRISPR CTGTTTGCAGAGAACAAGGA TGG Intergenic
No off target data available for this crispr