ID: 1098308488

View in Genome Browser
Species Human (GRCh38)
Location 12:69124782-69124804
Sequence CAGGGTAAGCACTCAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098308488_1098308491 -10 Left 1098308488 12:69124782-69124804 CCCACATCTGAGTGCTTACCCTG No data
Right 1098308491 12:69124795-69124817 GCTTACCCTGTGCCGGACCCTGG No data
1098308488_1098308494 -4 Left 1098308488 12:69124782-69124804 CCCACATCTGAGTGCTTACCCTG No data
Right 1098308494 12:69124801-69124823 CCTGTGCCGGACCCTGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098308488 Original CRISPR CAGGGTAAGCACTCAGATGT GGG (reversed) Intergenic
No off target data available for this crispr