ID: 1098312095

View in Genome Browser
Species Human (GRCh38)
Location 12:69158631-69158653
Sequence TTGGATAGACACACCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098312095_1098312098 14 Left 1098312095 12:69158631-69158653 CCTTGAAAGGTGTGTCTATCCAA No data
Right 1098312098 12:69158668-69158690 GACTCATACAGTAATAATTCTGG No data
1098312095_1098312099 15 Left 1098312095 12:69158631-69158653 CCTTGAAAGGTGTGTCTATCCAA No data
Right 1098312099 12:69158669-69158691 ACTCATACAGTAATAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098312095 Original CRISPR TTGGATAGACACACCTTTCA AGG (reversed) Intergenic
No off target data available for this crispr